After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Tyrosine Hydroxylase transcript variant 2 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human TH cDNA Clone Product Information
NCBI RefSeq:NM_000360.3
RefSeq ORF Size:1494bp
cDNA Description:Full length Clone DNA of Homo sapiens tyrosine hydroxylase, transcript variant 2.
Gene Synonym:TYH, TH
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human Tyrosine Hydroxylase transcript variant 2 natural ORF mammalian expression plasmid on other vectors
Product nameProduct name
Background

Tyrosine hydroxylase (TH) is a rate-limiting enzyme in catecholamine synthesis. Tyrosine hydroxylase activity is modulated by protein-protein interactions with enzymes in the same pathway or the tetrahydrobiopterin pathway, structural proteins considered to be chaperones that mediate the neuron's oxidative state. It is phosphorylated at serine (Ser) residues Ser8, Ser19, Ser31 and Ser40 in vitro. The phosphorylation of tyrosine hydroxylase at Ser19 or Ser8 has no direct effect on tyrosine hydroxylase activity. As tyrosine hydroxylase (TH) catalyses the formation of L-DOPA, the rate-limiting step in the biosynthesis of DA, the Parkinson's disease (PD) can be considered as a TH-deficiency syndrome of the striatum. A direct pathogenetic role of TH has also been suggested, as the enzyme is a source of reactive oxygen species (ROS) in vitro and a target for radical-mediated oxidative injury. Recently, it has been demonstrated that L-DOPA is effectively oxidized by mammalian Tyrosine hydroxylase in vitro, possibly contributing to the cytotoxic effects of DOPA.

References
  • Daubner SC, et al. (2011) Tyrosine hydroxylase and regulation of dopamine synthesis. Arch Biochem Biophys. 508(1): 1-12.
  • Dunkley PR, et al. (2004) Tyrosine hydroxylase phosphorylation: regulation and consequences. J Neurochem. 91(5): 1025-43.
  • Haavik J, et al. (1998) Tyrosine hydroxylase and Parkinson's disease. Mol Neurobiol. 16(3): 285-309.
  • Size / Price
    Catalog: HG10684-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"