Text Size:AAA

Human TH / Tyrosine Hydroxylase transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tag

  • Rat TFRC ORF mammalian expression plasmid, C-Flag tag
  • Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, C-Flag tag
DatasheetReviewsRelated ProductsProtocols
Human TH cDNA Clone Product Information
NCBI RefSeq:NM_000360.3
RefSeq ORF Size:1494bp
cDNA Description:Full length Clone DNA of Human tyrosine hydroxylase, transcript variant 2 with C terminal Flag tag.
Gene Synonym:TYH, TH
Restriction Site:KpnI + XbaI (two restriction sites) (6kb + 0.34kb + 1.21kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7( 5' TAATACGACTCACTATAGGG 3' )
( We provide with TH qPCR primers for gene expression analysis, HP100878 )
Promoter:Enhanced CMV cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human TH Gene Plasmid Map
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human TH / Tyrosine Hydroxylase transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tag on other vectors
Human TH / Tyrosine Hydroxylase transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10684-ACG$225
Human TH / Tyrosine Hydroxylase transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10684-ACR$225
Human TH / Tyrosine Hydroxylase transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10684-ANG$225
Human TH / Tyrosine Hydroxylase transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10684-ANR$225
Human TH / Tyrosine Hydroxylase transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10684-CF$195
Human TH / Tyrosine Hydroxylase transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tagHG10684-CH$195
Human TH / Tyrosine Hydroxylase transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10684-CM$195
Human TH / Tyrosine Hydroxylase transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tagHG10684-CY$195
Human TH / Tyrosine Hydroxylase transcript variant 2 Gene ORF cDNA clone in cloning vectorHG10684-M$75
Human TH / Tyrosine Hydroxylase transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10684-NF$195
Human TH / Tyrosine Hydroxylase transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His tagHG10684-NH$195
Human TH / Tyrosine Hydroxylase transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10684-NM$195
Human TH / Tyrosine Hydroxylase transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA tagHG10684-NY$195
Human TH / Tyrosine Hydroxylase transcript variant 2 Gene ORF cDNA clone expression plasmidHG10684-UT$195
 Learn more about expression Vectors
Product nameProduct name

Tyrosine hydroxylase (TH) is a rate-limiting enzyme in catecholamine synthesis. Tyrosine hydroxylase activity is modulated by protein-protein interactions with enzymes in the same pathway or the tetrahydrobiopterin pathway, structural proteins considered to be chaperones that mediate the neuron's oxidative state. It is phosphorylated at serine (Ser) residues Ser8, Ser19, Ser31 and Ser40 in vitro. The phosphorylation of tyrosine hydroxylase at Ser19 or Ser8 has no direct effect on tyrosine hydroxylase activity. As tyrosine hydroxylase (TH) catalyses the formation of L-DOPA, the rate-limiting step in the biosynthesis of DA, the Parkinson's disease (PD) can be considered as a TH-deficiency syndrome of the striatum. A direct pathogenetic role of TH has also been suggested, as the enzyme is a source of reactive oxygen species (ROS) in vitro and a target for radical-mediated oxidative injury. Recently, it has been demonstrated that L-DOPA is effectively oxidized by mammalian Tyrosine hydroxylase in vitro, possibly contributing to the cytotoxic effects of DOPA.

  • Daubner SC, et al. (2011) Tyrosine hydroxylase and regulation of dopamine synthesis. Arch Biochem Biophys. 508(1): 1-12.
  • Dunkley PR, et al. (2004) Tyrosine hydroxylase phosphorylation: regulation and consequences. J Neurochem. 91(5): 1025-43.
  • Haavik J, et al. (1998) Tyrosine hydroxylase and Parkinson's disease. Mol Neurobiol. 16(3): 285-309.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.