Quick Order

Text Size:AAA

Human TRP1 / TYRP1 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human TYRP1 cDNA Clone Product Information
NCBI RefSeq:NM_000550.2
RefSeq ORF Size:1614bp
cDNA Description:Full length Clone DNA of Homo sapiens tyrosinase-related protein 1 with N terminal Myc tag.
Gene Synonym:TRP, CAS2, CATB, GP75, TYRP, b-PROTEIN, TYRP1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Tyrosinase-related protein 1, also known as TYRP1 or TRP1, is a melanosomal enzyme that belongs to the tyrosinase family and plays an important role in the melanin biosynthetic pathway. Mutations in this enzyme are the cause of rufous oculocutaneous albinism and oculocutaneous albinism type III. TYRP1 / TRP1 is involved in the oxidation of 5,6-dihydroxyindole-2-carboxylic acid (DHICA) into indole-5,6-quinone-2-carboxylic acid. This enzyme may regulate or influence the type of melanin synthesized. The expression of Tyrosinase-related protein 1 (TYRP1) is regulated by the microphthalmia-associated transcription factor (MITF). There is mounting evidence demonstrating that in addition to its role in eumelanin synthesis, TYRP1 is involved in maintaining stability of tyrosinase proliferation and melanocyte cell death.

References
  • Sarangarajan R, et al. (2001) Tyrp1 and oculocutaneous albinism type 3. Pigment Cell Res. 14(6): 437-44.
  • Box NF, et al. (1998) Complete sequence and polymorphism study of the human TYRP1 gene encoding tyrosinase-related protein 1. Genome. 9 (1): 50-3.
  • Size / Price
    Catalog: HG13224-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"