Text Size:AAA

Human TRP1 / TYRP1 Gene ORF cDNA clone expression plasmid, N-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Human TYRP1 cDNA Clone Product Information
    NCBI RefSeq:NM_000550.2
    RefSeq ORF Size:1614bp
    cDNA Description:Full length Clone DNA of Homo sapiens tyrosinase-related protein 1 with N terminal Flag tag.
    Gene Synonym:TRP, CAS2, CATB, GP75, TYRP, b-PROTEIN, TYRP1
    Species:Human
    Vector:pCMV3-SP-N-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TYRP1 qPCR primers for gene expression analysis, HP102195 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    Tyrosinase-related protein 1, also known as TYRP1 or TRP1, is a melanosomal enzyme that belongs to the tyrosinase family and plays an important role in the melanin biosynthetic pathway. Mutations in this enzyme are the cause of rufous oculocutaneous albinism and oculocutaneous albinism type III. TYRP1 / TRP1 is involved in the oxidation of 5,6-dihydroxyindole-2-carboxylic acid (DHICA) into indole-5,6-quinone-2-carboxylic acid. This enzyme may regulate or influence the type of melanin synthesized. The expression of Tyrosinase-related protein 1 (TYRP1) is regulated by the microphthalmia-associated transcription factor (MITF). There is mounting evidence demonstrating that in addition to its role in eumelanin synthesis, TYRP1 is involved in maintaining stability of tyrosinase proliferation and melanocyte cell death.

    References
  • Sarangarajan R, et al. (2001) Tyrp1 and oculocutaneous albinism type 3. Pigment Cell Res. 14(6): 437-44.
  • Box NF, et al. (1998) Complete sequence and polymorphism study of the human TYRP1 gene encoding tyrosinase-related protein 1. Genome. 9 (1): 50-3.
  • Size / Price
    Catalog: HG13224-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"