TXNDC17 cDNA ORF Clone, Human, N-HA tag

Cat: HG11288-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TXNDC17 Reagents
CRO Services
Product recommended

All TXNDC17 Reagents
TXNDC17 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
372 bp
Description
Full length Clone DNA of Human thioredoxin domain containing 17 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TXNDC17 cDNA ORF Clone, Human, N-HA tag Alternative Names
TRP14 cDNA ORF Clone, Human;TXNL5 cDNA ORF Clone, Human
TXNDC17 Background Information
Full Name
thioredoxin domain containing 17
References
  • Holmgren A. (1985) Thioredoxin. Annu Rev Biochem. 54: 237-71.
  • Holmgren A. (1995) Thioredoxin structure and mechanism: conformational changes on oxidation of the active-site sulfhydryls to a disulfide. Structure. 3 (3): 239-43.
  • Martin JL. (1995) Thioredoxin--a fold for all reasons. Structure. 3 (3): 245-50.
  • TXNDC17 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TXNDC17 cDNA ORF Clone in Cloning Vector, Rat RG8A1943-U
    TXNDC17 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1943-ACGLN

    TXNDC17 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TXNDC17 cDNA ORF Clone in Cloning Vector, Mouse MG51578-G
    TXNDC17 cDNA ORF Clone, Mouse, untagged MG51578-UT
    TXNDC17 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51578-ACG
    TXNDC17 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51578-ACGLN
    TXNDC17 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51578-ANG
    TXNDC17 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51578-ACR
    TXNDC17 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51578-ANR
    TXNDC17 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51578-CF
    TXNDC17 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51578-NF
    TXNDC17 cDNA ORF Clone, Mouse, C-His tag MG51578-CH
    TXNDC17 cDNA ORF Clone, Mouse, N-His tag MG51578-NH
    TXNDC17 cDNA ORF Clone, Mouse, C-HA tag MG51578-CY
    TXNDC17 cDNA ORF Clone, Mouse, N-HA tag MG51578-NY
    TXNDC17 cDNA ORF Clone, Mouse, C-Myc tag MG51578-CM
    TXNDC17 cDNA ORF Clone, Mouse, N-Myc tag MG51578-NM
    TXNDC17 qPCR Primer Pairs, Mouse MP201461

    TXNDC17 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TXNDC17 cDNA ORF Clone in Cloning Vector, Human HG11288-M
    TXNDC17 cDNA ORF Clone, Human, untagged HG11288-UT
    TXNDC17 cDNA ORF Clone, Human, C-GFPSpark® tag HG11288-ACG
    TXNDC17 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11288-ACGLN
    TXNDC17 cDNA ORF Clone, Human, N-GFPSpark® tag HG11288-ANG
    TXNDC17 cDNA ORF Clone, Human, C-OFPSpark® tag HG11288-ACR
    TXNDC17 cDNA ORF Clone, Human, N-OFPSpark® tag HG11288-ANR
    TXNDC17 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11288-CF
    TXNDC17 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11288-NF
    TXNDC17 cDNA ORF Clone, Human, C-His tag HG11288-CH
    TXNDC17 cDNA ORF Clone, Human, N-His tag HG11288-NH
    TXNDC17 cDNA ORF Clone, Human, C-HA tag HG11288-CY
    TXNDC17 cDNA ORF Clone, Human, C-Myc tag HG11288-CM
    TXNDC17 cDNA ORF Clone, Human, N-Myc tag HG11288-NM
    TXNDC17 qPCR Primer Pairs, Human HP101166
    info info
    添加购物车成功! 添加购物车失败!