Quick Order

Human TXNDC17 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human TXNDC17 cDNA Clone Product Information
NCBI RefSeq:NM_032731.3
RefSeq ORF Size:372bp
cDNA Description:Full length Clone DNA of Homo sapiens thioredoxin domain containing 17.
Gene Synonym:TRP14, TXNL5, MGC14353, TXNDC17
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Holmgren A. (1985) Thioredoxin. Annu Rev Biochem. 54: 237-71.
  • Holmgren A. (1995) Thioredoxin structure and mechanism: conformational changes on oxidation of the active-site sulfhydryls to a disulfide. Structure. 3 (3): 239-43.
  • Martin JL. (1995) Thioredoxin--a fold for all reasons. Structure. 3 (3): 245-50.
  • Size / Price
    Catalog: HG11288-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"