Quick Order

Human TUSC2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human TUSC2 cDNA Clone Product Information
NCBI RefSeq:BC023976
RefSeq ORF Size:333bp
cDNA Description:Full length Clone DNA of Homo sapiens tumor suppressor candidate 2.
Gene Synonym:PAP, FUS1, PDAP2, C3orf11
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-TUSC2
Restriction Site:KpnI + XbaI (6.1kb + 0.33kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human TUSC2 Gene Plasmid Map
Human TUSC2 natural ORF mammalian expression plasmid
????��??????3?o?MG53720???������?o��?????o?????????��?����??���䡧?2??????�㨨���?1????������?��????????��????����騨���???
Product nameProduct name
Size / Price
Catalog: HG15406-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human TUSC2 natural ORF mammalian expression plasmid
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"