Quick Order

Text Size:AAA

Human TUBB2A natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human TUBB2A cDNA Clone Product Information
NCBI RefSeq:BC001194
RefSeq ORF Size:1338bp
cDNA Description:Full length Clone DNA of Homo sapiens tubulin, beta 2A class IIa.
Gene Synonym:TUBB, TUBB2, dJ40E16.7
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG14504-UT
List Price:   (Save )
Price:      [How to order]
Availability
 Shipping instructions
Size:
Quantity: