TUBAL3 cDNA ORF Clone, Human, C-Myc tag

Cat: HG15732-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TUBAL3 Reagents
CRO Services
Product recommended

All TUBAL3 Reagents
TUBAL3 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1221 bp
Description
Full length Clone DNA of Human tubulin, alpha-like 3 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TUBAL3 Background Information
Full Name
tubulin alpha like 3

TUBAL3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TUBAL3 cDNA ORF Clone in Cloning Vector, Mouse MG56297-U
TUBAL3 cDNA ORF Clone, Mouse, untagged MG56297-UT
TUBAL3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG56297-ACG
TUBAL3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG56297-ACGLN
TUBAL3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG56297-ANG
TUBAL3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG56297-ACR
TUBAL3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG56297-ANR
TUBAL3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG56297-CF
TUBAL3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG56297-NF
TUBAL3 cDNA ORF Clone, Mouse, C-His tag MG56297-CH
TUBAL3 cDNA ORF Clone, Mouse, N-His tag MG56297-NH
TUBAL3 cDNA ORF Clone, Mouse, C-HA tag MG56297-CY
TUBAL3 cDNA ORF Clone, Mouse, N-HA tag MG56297-NY
TUBAL3 cDNA ORF Clone, Mouse, C-Myc tag MG56297-CM
TUBAL3 cDNA ORF Clone, Mouse, N-Myc tag MG56297-NM

TUBAL3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TUBAL3 cDNA ORF Clone in Cloning Vector, Human HG15732-G
TUBAL3 cDNA ORF Clone, Human, untagged HG15732-UT
TUBAL3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15732-ACGLN
TUBAL3 cDNA ORF Clone, Human, C-GFPSpark® tag HG15732-ACG
TUBAL3 cDNA ORF Clone, Human, N-GFPSpark® tag HG15732-ANG
TUBAL3 cDNA ORF Clone, Human, C-OFPSpark® tag HG15732-ACR
TUBAL3 cDNA ORF Clone, Human, N-OFPSpark® tag HG15732-ANR
TUBAL3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15732-CF
TUBAL3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15732-NF
TUBAL3 cDNA ORF Clone, Human, C-His tag HG15732-CH
TUBAL3 cDNA ORF Clone, Human, N-His tag HG15732-NH
TUBAL3 cDNA ORF Clone, Human, C-HA tag HG15732-CY
TUBAL3 cDNA ORF Clone, Human, N-HA tag HG15732-NY
TUBAL3 cDNA ORF Clone, Human, N-Myc tag HG15732-NM
TUBAL3 qPCR Primer Pairs, Human HP104325
info info
添加购物车成功! 添加购物车失败!