TUBA8 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG12013-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TUBA8 Reagents
CRO Services
Product recommended

All TUBA8 Reagents
TUBA8 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1350 bp
Description
Full length Clone DNA of Human tubulin, alpha 8 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TUBA8 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
TUBAL2 cDNA ORF Clone, Human
TUBA8 Background Information
Full Name
tubulin, alpha 8

TUBA8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TUBA8 cDNA ORF Clone in Cloning Vector, Mouse MG53337-U
TUBA8 cDNA ORF Clone, Mouse, untagged MG53337-UT
TUBA8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53337-ACGLN
TUBA8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53337-ACG
TUBA8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53337-ANG
TUBA8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53337-ACR
TUBA8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53337-ANR
TUBA8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53337-CF
TUBA8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53337-NF
TUBA8 cDNA ORF Clone, Mouse, C-His tag MG53337-CH
TUBA8 cDNA ORF Clone, Mouse, N-His tag MG53337-NH
TUBA8 cDNA ORF Clone, Mouse, C-HA tag MG53337-CY
TUBA8 cDNA ORF Clone, Mouse, N-HA tag MG53337-NY
TUBA8 cDNA ORF Clone, Mouse, C-Myc tag MG53337-CM
TUBA8 cDNA ORF Clone, Mouse, N-Myc tag MG53337-NM

TUBA8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TUBA8 cDNA ORF Clone in Cloning Vector, Human HG12013-G
TUBA8 cDNA ORF Clone, Human, untagged HG12013-UT
TUBA8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12013-ACGLN
TUBA8 cDNA ORF Clone, Human, C-GFPSpark® tag HG12013-ACG
TUBA8 cDNA ORF Clone, Human, N-GFPSpark® tag HG12013-ANG
TUBA8 cDNA ORF Clone, Human, C-OFPSpark® tag HG12013-ACR
TUBA8 cDNA ORF Clone, Human, N-OFPSpark® tag HG12013-ANR
TUBA8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12013-G-F
TUBA8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12013-NF
TUBA8 cDNA ORF Clone, Human, C-His tag HG12013-CH
TUBA8 cDNA ORF Clone, Human, N-His tag HG12013-NH
TUBA8 cDNA ORF Clone, Human, C-HA tag HG12013-CY
TUBA8 cDNA ORF Clone, Human, N-HA tag HG12013-NY
TUBA8 cDNA ORF Clone, Human, C-Myc tag HG12013-CM
TUBA8 cDNA ORF Clone, Human, N-Myc tag HG12013-NM
TUBA8 qPCR Primer Pairs, Human HP101549
info info
添加购物车成功! 添加购物车失败!