TTYH2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG15740-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TTYH2 Reagents
CRO Services
Product recommended

All TTYH2 Reagents
TTYH2 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1605 bp
Description
Full length Clone DNA of Human tweety homolog 2 (Drosophila) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TTYH2 cDNA ORF Clone, Human, C-Myc tag Alternative Names
C17orf29 cDNA ORF Clone, Human
TTYH2 Background Information
Full Name
tweety family member 2

TTYH2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TTYH2 cDNA ORF Clone in Cloning Vector, Mouse MG5A5806-U
TTYH2 cDNA ORF Clone, Mouse, untagged MG5A5806-UT
TTYH2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5806-ACG
TTYH2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5806-ACGLN
TTYH2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5806-ANG
TTYH2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5806-ACR
TTYH2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5806-ANR
TTYH2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5806-CF
TTYH2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5806-NF
TTYH2 cDNA ORF Clone, Mouse, C-His tag MG5A5806-CH
TTYH2 cDNA ORF Clone, Mouse, N-His tag MG5A5806-NH
TTYH2 cDNA ORF Clone, Mouse, C-HA tag MG5A5806-CY
TTYH2 cDNA ORF Clone, Mouse, N-HA tag MG5A5806-NY
TTYH2 cDNA ORF Clone, Mouse, C-Myc tag MG5A5806-CM
TTYH2 cDNA ORF Clone, Mouse, N-Myc tag MG5A5806-NM

TTYH2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TTYH2 cDNA ORF Clone in Cloning Vector, Human HG15740-G
TTYH2 cDNA ORF Clone, Human, untagged HG15740-UT
TTYH2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15740-ACG
TTYH2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15740-ACGLN
TTYH2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15740-ACR
TTYH2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15740-CF
TTYH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15740-NF
TTYH2 cDNA ORF Clone, Human, C-His tag HG15740-CH
TTYH2 cDNA ORF Clone, Human, N-His tag HG15740-NH
TTYH2 cDNA ORF Clone, Human, C-HA tag HG15740-CY
TTYH2 cDNA ORF Clone, Human, N-HA tag HG15740-NY
TTYH2 cDNA ORF Clone, Human, N-Myc tag HG15740-NM
TTYH2 qPCR Primer Pairs, Human HP104333
info info
添加购物车成功! 添加购物车失败!