TROP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10428-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TROP2 Reagents
CRO Services
Product recommended

All TROP2 Reagents
TROP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1011 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tumor-associated calcium signal transducer 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI(6kb+1.01kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TROP2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TROP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
TROP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
EGP-1 cDNA ORF Clone, Human;EGP1 cDNA ORF Clone, Human;GA733-1 cDNA ORF Clone, Human;GA7331 cDNA ORF Clone, Human;GP50 cDNA ORF Clone, Human;M1S1 cDNA ORF Clone, Human;TACD2 cDNA ORF Clone, Human;TROP-2 cDNA ORF Clone, Human;TROP2 cDNA ORF Clone, Human
TROP2 Background Information

TROP-2, also referred to as tumor associated calcium signal transducer 2 (TACSTD2), GA733-1 or M1S1, is a cell surface glycoprotein highly expressed in a wide variety of epithelial cancers. In contrast, there is little or no expression of Trop-2 in adult somatic tissue. Because it is a cell surface protein that is selectively expressed in tumor cells, Trop-2 is a potential therapeutic target. The cytoplasmic tail of Trop-2 possesses potential serine and tyrosine phosphorylation sites and a phosphatidyl-inositol binding consensus sequence. Trop-2 transduces an intracellular calcium signal, are consistent with the hypothesis that it acts as a cell surface receptor and support a search for a physiological ligand. TROP2 encoding by an intronless gene was originally defined by the monoclonal antibody GA733, and is a member of a family of at least two type I membrane proteins. The other known member is GA733-2, also called EpCAM and TROP1. It has been suggested by studies that the GA733-1 gene was formed by the retroposition of the GA733-2 gene via an mRNA intermediate.

Full Name
tumor-associated calcium signal transducer 2
References
  • Ripani E, et al. (1998) Human Trop-2 is a tumor-associated calcium signal transducer. Int J Cancer. 76(5): 671-6.
  • Wang J, et al. (2008) Identification of Trop-2 as an oncogene and an attractive therapeutic target in colon cancers. Mol Cancer Ther. 7(2): 280-5.
  • TROP2 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    TROP2 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90893-CF

    TROP2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TROP2 cDNA ORF Clone, Rat, untagged RG86246-UT
    TROP2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG86246-ACG
    TROP2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86246-ACGLN
    TROP2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG86246-ACR
    TROP2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG86246-CF
    TROP2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG86246-NF
    TROP2 cDNA ORF Clone, Rat, C-His tag RG86246-CH
    TROP2 cDNA ORF Clone, Rat, N-His tag RG86246-NH
    TROP2 cDNA ORF Clone, Rat, C-HA tag RG86246-CY
    TROP2 cDNA ORF Clone, Rat, N-HA tag RG86246-NY
    TROP2 cDNA ORF Clone, Rat, C-Myc tag RG86246-CM
    TROP2 cDNA ORF Clone, Rat, N-Myc tag RG86246-NM

    TROP2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TROP2 cDNA ORF Clone in Cloning Vector, Mouse MG50922-G
    TROP2 cDNA ORF Clone, Mouse, untagged MG50922-UT
    TROP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50922-ACG
    TROP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50922-ACGLN
    TROP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50922-ACR
    TROP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50922-CF
    TROP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50922-NF
    TROP2 cDNA ORF Clone, Mouse, C-His tag MG50922-CH
    TROP2 cDNA ORF Clone, Mouse, N-His tag MG50922-NH
    TROP2 cDNA ORF Clone, Mouse, C-HA tag MG50922-CY
    TROP2 cDNA ORF Clone, Mouse, N-HA tag MG50922-NY
    TROP2 cDNA ORF Clone, Mouse, C-Myc tag MG50922-CM
    TROP2 cDNA ORF Clone, Mouse, N-Myc tag MG50922-NM
    TROP2 qPCR Primer Pairs, Mouse MP200891

    TROP2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TROP2 cDNA ORF Clone in Cloning Vector, Human HG10428-M
    TROP2 cDNA ORF Clone, Human, untagged HG10428-UT
    TROP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10428-ACG
    TROP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10428-ACGLN
    TROP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10428-ACR
    TROP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10428-NF
    TROP2 cDNA ORF Clone, Human, C-His tag HG10428-CH
    TROP2 cDNA ORF Clone, Human, N-His tag HG10428-NH
    TROP2 cDNA ORF Clone, Human, C-HA tag HG10428-CY
    TROP2 cDNA ORF Clone, Human, N-HA tag HG10428-NY
    TROP2 cDNA ORF Clone, Human, C-Myc tag HG10428-CM
    TROP2 cDNA ORF Clone, Human, N-Myc tag HG10428-NM
    TROP2 qPCR Primer Pairs, Human HP100458
    info info
    添加购物车成功! 添加购物车失败!