RFP2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14192-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RFP2 Reagents
CRO Services
Product recommended

All RFP2 Reagents
RFP2 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1224 bp
Description
Full length Clone DNA of Human tripartite motif containing 13 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RFP2 cDNA ORF Clone, Human, C-Myc tag Alternative Names
CAR cDNA ORF Clone, Human;DLEU5 cDNA ORF Clone, Human;LEU5 cDNA ORF Clone, Human;RFP2 cDNA ORF Clone, Human;RNF77 cDNA ORF Clone, Human
RFP2 Background Information
Full Name
tripartite motif containing 13

RFP2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RFP2 cDNA ORF Clone in Cloning Vector, Mouse MG5A2609-U
RFP2 cDNA ORF Clone, Mouse, untagged MG5A2609-UT
RFP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2609-ACGLN
RFP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2609-ACG
RFP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2609-ANG
RFP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2609-ACR
RFP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2609-ANR
RFP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2609-CF
RFP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2609-NF
RFP2 cDNA ORF Clone, Mouse, C-His tag MG5A2609-CH
RFP2 cDNA ORF Clone, Mouse, N-His tag MG5A2609-NH
RFP2 cDNA ORF Clone, Mouse, C-HA tag MG5A2609-CY
RFP2 cDNA ORF Clone, Mouse, N-HA tag MG5A2609-NY
RFP2 cDNA ORF Clone, Mouse, C-Myc tag MG5A2609-CM
RFP2 cDNA ORF Clone, Mouse, N-Myc tag MG5A2609-NM

RFP2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RFP2 cDNA ORF Clone in Cloning Vector, Human HG14192-G
RFP2 cDNA ORF Clone, Human, untagged HG14192-UT
RFP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14192-ACGLN
RFP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14192-ACG
RFP2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14192-ANG
RFP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14192-ACR
RFP2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14192-ANR
RFP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14192-CF
RFP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14192-NF
RFP2 cDNA ORF Clone, Human, C-His tag HG14192-CH
RFP2 cDNA ORF Clone, Human, N-His tag HG14192-NH
RFP2 cDNA ORF Clone, Human, C-HA tag HG14192-CY
RFP2 cDNA ORF Clone, Human, N-HA tag HG14192-NY
RFP2 cDNA ORF Clone, Human, N-Myc tag HG14192-NM
RFP2 qPCR Primer Pairs, Human HP102843
info info
添加购物车成功! 添加购物车失败!