TRIB2 cDNA ORF Clone, Human, untagged

Cat: HG10725-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TRIB2 Reagents
CRO Services
Product recommended

All TRIB2 Reagents
TRIB2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1032 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tribbles homolog 2 (Drosophila).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
HindIII + XbaI (6.1kb + 1.03kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TRIB2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TRIB2 cDNA ORF Clone, Human, untagged Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5624
TRIB2 cDNA ORF Clone, Human, untagged Alternative Names
C5FW cDNA ORF Clone, Human;FLJ57420 cDNA ORF Clone, Human;GS3955 cDNA ORF Clone, Human;TRB2 cDNA ORF Clone, Human;TRIB2 cDNA ORF Clone, Human
TRIB2 Background Information

Tribbles homolog 2, also known as TRB-2, and Trib2, is a member of the protein kinase superfamily and Tribbles subfamily (Trib1, Trib2, Trib3). The identification of tribbles as regulators of signal processing systems and physiological processes, including development, together with their potential involvement in diabetes and cancer, has generated considerable interest in these proteins. Tribbles have been reported to regulate activation of a number of intracellular signalling pathways with roles extending from mitosis and cell activation to apoptosis and modulation of gene expression. Tribbles controls the timing of mitosis in the prospective mesoderm, allowing cell-shape changes to be completed. This mechanism for coordinating cell division and cell-shape changes may have helped Drosophila to evolve its mode of rapid early development. Trib2 was identified as a downregulated transcript in leukemic cells undergoing growth arrest. Trib2-transduced bone marrow cells exhibited a growth advantage and readily established factor-dependent cell lines. Trib2-reconstituted mice uniformly developed fatal transplantable acute myelogenous leukemia (AML).

Full Name
tribbles pseudokinase 2
References
  • Seher, TC. et al., 2000, Curr Biol. 10 (11): 623-9.
  • Keeshan, K. et al., 2006, Cancer Cell. 10 (5): 401-11.
  • Hegedus, Z. et al., 2007, Cell Signal. 19 (2):238-50.
  • Keeshan, K. et al., 2008, Blood Cells Mol Dis. 40 (1): 119-21.
  • Cvetkovic, LV. et al., 2010, J Clin Invest. 120 (3): 713-9.
  • TRIB2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TRIB2 cDNA ORF Clone in Cloning Vector, Mouse MG50885-G
    TRIB2 cDNA ORF Clone, Mouse, untagged MG50885-UT
    TRIB2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50885-ACG
    TRIB2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50885-ACGLN
    TRIB2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50885-ANG
    TRIB2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50885-ACR
    TRIB2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50885-ANR
    TRIB2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50885-CF
    TRIB2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50885-NF
    TRIB2 cDNA ORF Clone, Mouse, C-His tag MG50885-CH
    TRIB2 cDNA ORF Clone, Mouse, N-His tag MG50885-NH
    TRIB2 cDNA ORF Clone, Mouse, C-HA tag MG50885-CY
    TRIB2 cDNA ORF Clone, Mouse, N-HA tag MG50885-NY
    TRIB2 cDNA ORF Clone, Mouse, C-Myc tag MG50885-CM
    TRIB2 cDNA ORF Clone, Mouse, N-Myc tag MG50885-NM
    TRIB2 qPCR Primer Pairs, Mouse MP200856

    TRIB2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TRIB2 cDNA ORF Clone in Cloning Vector, Human HG10725-M
    TRIB2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10725-ACGLN
    TRIB2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10725-ACG
    TRIB2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10725-ANG
    TRIB2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10725-ACR
    TRIB2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10725-ANR
    TRIB2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10725-CF
    TRIB2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10725-NF
    TRIB2 cDNA ORF Clone, Human, C-His tag HG10725-CH
    TRIB2 cDNA ORF Clone, Human, N-His tag HG10725-NH
    TRIB2 cDNA ORF Clone, Human, C-HA tag HG10725-CY
    TRIB2 cDNA ORF Clone, Human, N-HA tag HG10725-NY
    TRIB2 cDNA ORF Clone, Human, C-Myc tag HG10725-CM
    TRIB2 cDNA ORF Clone, Human, N-Myc tag HG10725-NM
    TRIB2 qPCR Primer Pairs, Human HP100664
    info info
    添加购物车成功! 添加购物车失败!