Quick Order

Text Size:AAA

Human TRIB2 / TRB2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human TRIB2 cDNA Clone Product Information
NCBI RefSeq:NM_021643.3
RefSeq ORF Size:1032bp
cDNA Description:Full length Clone DNA of Homo sapiens tribbles homolog 2 (Drosophila).
Gene Synonym:C5FW, TRB2, GS3955, TRIB2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-TRIB2
Restriction Site:HindIII + XbaI (6.1kb + 1.03kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human TRIB2 Gene Plasmid Map
Human TRIB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Tribbles homolog 2, also known as TRB-2, and Trib2, is a member of the protein kinase superfamily and Tribbles subfamily (Trib1, Trib2, Trib3). The identification of tribbles as regulators of signal processing systems and physiological processes, including development, together with their potential involvement in diabetes and cancer, has generated considerable interest in these proteins. Tribbles have been reported to regulate activation of a number of intracellular signalling pathways with roles extending from mitosis and cell activation to apoptosis and modulation of gene expression. Tribbles controls the timing of mitosis in the prospective mesoderm, allowing cell-shape changes to be completed. This mechanism for coordinating cell division and cell-shape changes may have helped Drosophila to evolve its mode of rapid early development. Trib2 was identified as a downregulated transcript in leukemic cells undergoing growth arrest. Trib2-transduced bone marrow cells exhibited a growth advantage and readily established factor-dependent cell lines. Trib2-reconstituted mice uniformly developed fatal transplantable acute myelogenous leukemia (AML).

References
  • Seher, TC. et al., 2000, Curr Biol. 10 (11): 623-9.
  • Keeshan, K. et al., 2006, Cancer Cell. 10 (5): 401-11.
  • Hegedus, Z. et al., 2007, Cell Signal. 19 (2):238-50.
  • Keeshan, K. et al., 2008, Blood Cells Mol Dis. 40 (1): 119-21.
  • Cvetkovic, LV. et al., 2010, J Clin Invest. 120 (3): 713-9.
  • Size / Price
    Catalog: HG10725-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human TRIB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"