Quick Order

Text Size:AAA

Human TPSB2 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human TPSB2 cDNA Clone Product Information
NCBI RefSeq:NM_024164.5
RefSeq ORF Size:828bp
cDNA Description:Full length Clone DNA of Homo sapiens tryptase beta 2 with C terminal His tag.
Gene Synonym:TPS2, TPSB1, tryptaseC
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1, and fall into two groups, α and β. β-tryptases appear to be the main isoenzymes expressed in mast cells, whereas α-tryptases predominate in basophils. Tryptase is unique in two respects: it is enzymatically active only as a heparin-stabilized tetramer, and it is resistant to all known endogenous proteinase inhibitors because of the unique arrangement of the active sites. Additionally, tryptase family genes have an intron immediately upstream of the initiator codon which separates the transcription initiation site from protein coding sequence, and this feature is characteristic of tryptases. β-tryptases existing in three isoforms (β1,β2,β3) are released in secretory granules, and have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. It has been reported that β-tryptase selectively cleaves ASM-derived eotaxin and RANTES and abrogates their chemotactic activities.

References
  • Miller, J.S. et al., 1990, J. Clin. Invest. 86: 864-870.
  • Pereira, P.J. et al., 1998, Nature. 392: 306-311.
  • Pallaoro, M.et al., 1999, J. Biol. Chem. 274: 3355-3362.
  • Pang, L. et al., 2006, J. Immunol. 176: 3788-3795.
  • Size / Price
    Catalog: HG10505-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"