TPM1 cDNA ORF Clone, Human, C-HA tag

Cat: HG14615-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TPM1 Reagents
CRO Services
Product recommended

All TPM1 Reagents
TPM1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
855 bp
Description
Full length Clone DNA of Human tropomyosin 1 (alpha) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TPM1 cDNA ORF Clone, Human, C-HA tag Alternative Names
C15orf13 cDNA ORF Clone, Human;CMD1Y cDNA ORF Clone, Human;CMH3 cDNA ORF Clone, Human;HTM-alpha cDNA ORF Clone, Human;LVNC9 cDNA ORF Clone, Human;TMSA cDNA ORF Clone, Human
TPM1 Background Information

TPM1, also known as tropomyosin-1, is a member of the tropomyosin family. Members of this family are highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. TPM1 is one type of alpha helical chain that forms the predominant tropomyosin of striated muscle. It binds to actin filaments in muscle and non-muscle cells. TPM1 plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction.

Full Name
tropomyosin 1 (alpha)
References
  • Mogensen J. et al., 1999, Cytogenet Cell Genet. 84 (1-2): 35-6.
  • Brown H R. et al., 1985, Proc Natl Acad Sci. 82 (8): 2359-63.
  • Lees-Miller JP. et al., 1992, BioEssays. 13 (9): 429-37.
  • TPM1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TPM1 cDNA ORF Clone in Cloning Vector, Rat RG82243-U
    TPM1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82243-ACGLN

    TPM1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TPM1 cDNA ORF Clone in Cloning Vector, Mouse MG52560-G
    TPM1 cDNA ORF Clone in Cloning Vector, Mouse MG51274-G
    TPM1 cDNA ORF Clone, Mouse, untagged MG51274-UT
    TPM1 cDNA ORF Clone, Mouse, untagged MG52560-UT
    TPM1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52560-ACG
    TPM1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51274-ACG
    TPM1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51274-ACGLN
    TPM1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52560-ACGLN
    TPM1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52560-ANG
    TPM1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51274-ANG
    TPM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52560-ACR
    TPM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51274-ACR
    TPM1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51274-ANR
    TPM1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52560-ANR
    TPM1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52560-CF
    TPM1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51274-CF
    TPM1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52560-NF
    TPM1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51274-NF
    TPM1 cDNA ORF Clone, Mouse, C-His tag MG52560-CH
    TPM1 cDNA ORF Clone, Mouse, C-His tag MG51274-CH
    TPM1 cDNA ORF Clone, Mouse, N-His tag MG52560-NH
    TPM1 cDNA ORF Clone, Mouse, N-His tag MG51274-NH
    TPM1 cDNA ORF Clone, Mouse, C-HA tag MG52560-CY
    TPM1 cDNA ORF Clone, Mouse, C-HA tag MG51274-CY
    TPM1 cDNA ORF Clone, Mouse, N-HA tag MG52560-NY
    TPM1 cDNA ORF Clone, Mouse, N-HA tag MG51274-NY
    TPM1 cDNA ORF Clone, Mouse, C-Myc tag MG52560-CM
    TPM1 cDNA ORF Clone, Mouse, C-Myc tag MG51274-CM
    TPM1 cDNA ORF Clone, Mouse, N-Myc tag MG51274-NM
    TPM1 cDNA ORF Clone, Mouse, N-Myc tag MG52560-NM
    TPM1 qPCR Primer Pairs, Mouse MP201156

    TPM1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TPM1 cDNA ORF Clone in Cloning Vector, Human HG14615-G
    TPM1 cDNA ORF Clone, Human, untagged HG14615-UT
    TPM1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14615-ACG
    TPM1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14615-ACGLN
    TPM1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14615-ANG
    TPM1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14615-ACR
    TPM1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14615-ANR
    TPM1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14615-CF
    TPM1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14615-NF
    TPM1 cDNA ORF Clone, Human, C-His tag HG14615-CH
    TPM1 cDNA ORF Clone, Human, N-His tag HG14615-NH
    TPM1 cDNA ORF Clone, Human, N-HA tag HG14615-NY
    TPM1 cDNA ORF Clone, Human, C-Myc tag HG14615-CM
    TPM1 cDNA ORF Clone, Human, N-Myc tag HG14615-NM
    TPM1 qPCR Primer Pairs, Human HP103249
    info info
    添加购物车成功! 添加购物车失败!