Quick Order

Human TPM1 / Tropomyosin-1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human TPM1 cDNA Clone Product Information
NCBI RefSeq:BC007433
RefSeq ORF Size:855bp
cDNA Description:Full length Clone DNA of Homo sapiens tropomyosin 1 (alpha) with C terminal His tag.
Gene Synonym:CMH3, TMSA, CMD1Y, C15orf13, HTM-alpha
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

TPM1, also known as tropomyosin-1, is a member of the tropomyosin family. Members of this family are highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. TPM1 is one type of alpha helical chain that forms the predominant tropomyosin of striated muscle. It binds to actin filaments in muscle and non-muscle cells. TPM1 plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction.

References
  • Mogensen J. et al., 1999, Cytogenet Cell Genet. 84 (1-2): 35-6.
  • Brown H R. et al., 1985, Proc Natl Acad Sci. 82 (8): 2359-63.
  • Lees-Miller JP. et al., 1992, BioEssays. 13 (9): 429-37.
  • Size / Price
    Catalog: HG14615-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"