TPK1 cDNA ORF Clone, Human, untagged

Cat: HG15390-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TPK1 Reagents
CRO Services
Product recommended

All TPK1 Reagents
TPK1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
732 bp
Description
Full length Clone DNA of Human thiamin pyrophosphokinase 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TPK1 cDNA ORF Clone, Human, untagged Alternative Names
HTPK1 cDNA ORF Clone, Human;PP20 cDNA ORF Clone, Human;THMD5 cDNA ORF Clone, Human
TPK1 Background Information
Full Name
thiamin pyrophosphokinase 1

TPK1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TPK1 cDNA ORF Clone in Cloning Vector, Mouse MG5A1564-U
TPK1 cDNA ORF Clone, Mouse, untagged MG5A1564-UT
TPK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1564-ACGLN
TPK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1564-ACG
TPK1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1564-ANG
TPK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1564-ACR
TPK1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1564-ANR
TPK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1564-CF
TPK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1564-NF
TPK1 cDNA ORF Clone, Mouse, C-His tag MG5A1564-CH
TPK1 cDNA ORF Clone, Mouse, N-His tag MG5A1564-NH
TPK1 cDNA ORF Clone, Mouse, C-HA tag MG5A1564-CY
TPK1 cDNA ORF Clone, Mouse, N-HA tag MG5A1564-NY
TPK1 cDNA ORF Clone, Mouse, C-Myc tag MG5A1564-CM
TPK1 cDNA ORF Clone, Mouse, N-Myc tag MG5A1564-NM

TPK1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TPK1 cDNA ORF Clone in Cloning Vector, Human HG15390-G
TPK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15390-ACGLN
TPK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15390-ACG
TPK1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15390-ANG
TPK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15390-ACR
TPK1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15390-ANR
TPK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15390-CF
TPK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15390-NF
TPK1 cDNA ORF Clone, Human, C-His tag HG15390-CH
TPK1 cDNA ORF Clone, Human, N-His tag HG15390-NH
TPK1 cDNA ORF Clone, Human, C-HA tag HG15390-CY
TPK1 cDNA ORF Clone, Human, N-HA tag HG15390-NY
TPK1 cDNA ORF Clone, Human, C-Myc tag HG15390-CM
TPK1 cDNA ORF Clone, Human, N-Myc tag HG15390-NM
TPK1 qPCR Primer Pairs, Human HP104014
info info
添加购物车成功! 添加购物车失败!