TPD52L1 cDNA ORF Clone, Human, N-His tag

Cat: HG14330-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TPD52L1 Reagents
CRO Services
Product recommended

All TPD52L1 Reagents
TPD52L1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
435 bp
Description
Full length Clone DNA of Human tumor protein D52-like 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TPD52L1 cDNA ORF Clone, Human, N-His tag Alternative Names
D53 cDNA ORF Clone, Human;hD53 cDNA ORF Clone, Human
TPD52L1 Background Information
Full Name
tumor protein D52-like 1

TPD52L1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TPD52L1 cDNA ORF Clone in Cloning Vector, Mouse MG52700-G
TPD52L1 cDNA ORF Clone, Mouse, untagged MG52700-UT
TPD52L1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52700-ACGLN
TPD52L1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52700-ACG
TPD52L1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52700-ANG
TPD52L1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52700-ACR
TPD52L1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52700-ANR
TPD52L1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52700-CF
TPD52L1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52700-NF
TPD52L1 cDNA ORF Clone, Mouse, C-His tag MG52700-CH
TPD52L1 cDNA ORF Clone, Mouse, N-His tag MG52700-NH
TPD52L1 cDNA ORF Clone, Mouse, C-HA tag MG52700-CY
TPD52L1 cDNA ORF Clone, Mouse, N-HA tag MG52700-NY
TPD52L1 cDNA ORF Clone, Mouse, C-Myc tag MG52700-CM
TPD52L1 cDNA ORF Clone, Mouse, N-Myc tag MG52700-NM
TPD52L1 qPCR Primer Pairs, Mouse MP202571

TPD52L1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TPD52L1 cDNA ORF Clone in Cloning Vector, Human HG14330-G
TPD52L1 cDNA ORF Clone, Human, untagged HG14330-UT
TPD52L1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14330-ACGLN
TPD52L1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14330-ACG
TPD52L1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14330-ANG
TPD52L1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14330-ACR
TPD52L1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14330-ANR
TPD52L1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14330-CF
TPD52L1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14330-NF
TPD52L1 cDNA ORF Clone, Human, C-His tag HG14330-CH
TPD52L1 cDNA ORF Clone, Human, C-HA tag HG14330-CY
TPD52L1 cDNA ORF Clone, Human, N-HA tag HG14330-NY
TPD52L1 cDNA ORF Clone, Human, C-Myc tag HG14330-CM
TPD52L1 cDNA ORF Clone, Human, N-Myc tag HG14330-NM
TPD52L1 qPCR Primer Pairs, Human HP102980
info info
添加购物车成功! 添加购物车失败!