p63 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13226-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All p63 Reagents
CRO Services
Product recommended

All p63 Reagents
p63 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2043 bp
Description
Full length Clone DNA of Human tumor protein p63 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

p63 cDNA ORF Clone, Human, N-Myc tag Alternative Names
AIS cDNA ORF Clone, Human;B(p51A) cDNA ORF Clone, Human;B(p51B) cDNA ORF Clone, Human;EEC3 cDNA ORF Clone, Human;KET cDNA ORF Clone, Human;LMS cDNA ORF Clone, Human;NBP cDNA ORF Clone, Human;OFC8 cDNA ORF Clone, Human;p40 cDNA ORF Clone, Human;p51 cDNA ORF Clone, Human;p53CP cDNA ORF Clone, Human;p63 cDNA ORF Clone, Human;p73H cDNA ORF Clone, Human;p73L cDNA ORF Clone, Human;RHS cDNA ORF Clone, Human;SHFM4 cDNA ORF Clone, Human;TP53CP cDNA ORF Clone, Human;TP53L cDNA ORF Clone, Human;TP73L cDNA ORF Clone, Human
p63 Background Information

Tumor protein p63 is a protein also known as transformation-related protein 63, TP63, and p63. Tumor protein p63 / p63 is a member of the p53 family of transcription factors whose members P53, p63, and p73 have similar features in their gene structures and functions. An animal model, p63-/- mice has been useful in difining the role p63 plays in the development and maintenance of stratified epithelial tissues. This p63 encoding protein p63 has a dramatic impact on replenishment of cutaneous epithelial stem cells and on ovarian germ cell survival. Although these two fundamental roles of p63 attest to its powerful place in development, its other functions, specifically the apparent capacity of p63, is to supervise the emergence of new cell populations in the breast, prostate, cervix, and upper reproductive tract. P63-/- mice have several development defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Mutations in this protein are associated with ectodermal dysplasia, and cleft lip / palate syndrome 3, ADULT syndrome (acro-dermato-ungual-lacrimal-tooth), limb-mammary syndrome, et al.

Full Name
tumor protein p63
References
  • Crum CP, et al. (2010) p63 in epithelial survival, germ cell surveillance, and neoplasia. Annu Rev Pathol. 5: 349-71.
  • Tan M, et al. (2001) p53CP is p51/p63, the third member of the p53 gene family: partial purification and characterization. Carcinogenesis. 22 (2): 295-300.
  • Shiran MS, et al. (2007) p63 as a complementary basal cell specific marker to high molecular weight-cytokeratin in distinguishing prostatic carcinoma from benign prostatic lesions. Med J Malaysia. 62 (1): 36-9.
  • info info
    添加购物车成功! 添加购物车失败!