Text Size:AAA

Human p63 / TP63 Gene ORF cDNA clone expression plasmid, N-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Human TP63 cDNA Clone Product Information
    NCBI RefSeq:BC039815
    RefSeq ORF Size:2043bp
    cDNA Description:Full length Clone DNA of Homo sapiens tumor protein p63 with N terminal Flag tag.
    Gene Synonym:AIS, KET, LMS, NBP, RHS, p40, p51, p63, EEC3, OFC8, p73H, p73L, SHFM4, TP53L, TP73L, p53CP, TP53CP, B(p51A), B(p51B), TP63
    Species:Human
    Vector:pCMV3-N-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TP63 qPCR primers for gene expression analysis, HP102339 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    Tumor protein p63 is a protein also known as transformation-related protein 63, TP63, and p63. Tumor protein p63 / p63 is a member of the p53 family of transcription factors whose members P53, p63, and p73 have similar features in their gene structures and functions. An animal model, p63-/- mice has been useful in difining the role p63 plays in the development and maintenance of stratified epithelial tissues. This p63 encoding protein p63 has a dramatic impact on replenishment of cutaneous epithelial stem cells and on ovarian germ cell survival. Although these two fundamental roles of p63 attest to its powerful place in development, its other functions, specifically the apparent capacity of p63, is to supervise the emergence of new cell populations in the breast, prostate, cervix, and upper reproductive tract. P63-/- mice have several development defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Mutations in this protein are associated with ectodermal dysplasia, and cleft lip / palate syndrome 3, ADULT syndrome (acro-dermato-ungual-lacrimal-tooth), limb-mammary syndrome, et al.

    References
  • Crum CP, et al. (2010) p63 in epithelial survival, germ cell surveillance, and neoplasia. Annu Rev Pathol. 5: 349-71.
  • Tan M, et al. (2001) p53CP is p51/p63, the third member of the p53 gene family: partial purification and characterization. Carcinogenesis. 22 (2): 295-300.
  • Shiran MS, et al. (2007) p63 as a complementary basal cell specific marker to high molecular weight-cytokeratin in distinguishing prostatic carcinoma from benign prostatic lesions. Med J Malaysia. 62 (1): 36-9.
  • Size / Price
    Catalog: HG13226-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"