TOMM5 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15104-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TOMM5 Reagents
CRO Services
Product recommended

All TOMM5 Reagents
TOMM5 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
156 bp
Description
Full length Clone DNA of Human translocase of outer mitochondrial membrane 5 homolog (yeast) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TOMM5 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
bA613M10.3 cDNA ORF Clone, Human;C9orf105 cDNA ORF Clone, Human;Tom5 cDNA ORF Clone, Human
TOMM5 Background Information
Full Name
translocase of outer mitochondrial membrane 5 homolog (yeast)

TOMM5 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
TOMM5 cDNA ORF Clone in Cloning Vector, Rabbit TG65075-G
TOMM5 cDNA ORF Clone, Rabbit, untagged TG65075-UT
TOMM5 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65075-ACG
TOMM5 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65075-ANG
TOMM5 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65075-ACR
TOMM5 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65075-ANR
TOMM5 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65075-CF
TOMM5 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65075-NF
TOMM5 cDNA ORF Clone, Rabbit, C-His tag TG65075-CH
TOMM5 cDNA ORF Clone, Rabbit, N-His tag TG65075-NH
TOMM5 cDNA ORF Clone, Rabbit, C-HA tag TG65075-CY
TOMM5 cDNA ORF Clone, Rabbit, N-HA tag TG65075-NY
TOMM5 cDNA ORF Clone, Rabbit, C-Myc tag TG65075-CM
TOMM5 cDNA ORF Clone, Rabbit, N-Myc tag TG65075-NM

TOMM5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TOMM5 cDNA ORF Clone in Cloning Vector, Human HG15104-G
TOMM5 cDNA ORF Clone, Human, untagged HG15104-UT
TOMM5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15104-ACGLN
TOMM5 cDNA ORF Clone, Human, C-GFPSpark® tag HG15104-ACG
TOMM5 cDNA ORF Clone, Human, N-GFPSpark® tag HG15104-ANG
TOMM5 cDNA ORF Clone, Human, C-OFPSpark® tag HG15104-ACR
TOMM5 cDNA ORF Clone, Human, N-OFPSpark® tag HG15104-ANR
TOMM5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15104-NF
TOMM5 cDNA ORF Clone, Human, C-His tag HG15104-CH
TOMM5 cDNA ORF Clone, Human, N-His tag HG15104-NH
TOMM5 cDNA ORF Clone, Human, C-HA tag HG15104-CY
TOMM5 cDNA ORF Clone, Human, N-HA tag HG15104-NY
TOMM5 cDNA ORF Clone, Human, C-Myc tag HG15104-CM
TOMM5 cDNA ORF Clone, Human, N-Myc tag HG15104-NM
TOMM5 qPCR Primer Pairs, Human HP103731
info info
添加购物车成功! 添加购物车失败!