TOMM40L cDNA ORF Clone, Human, N-His tag

Cat: HG15418-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TOMM40L Reagents
CRO Services
Product recommended

All TOMM40L Reagents
TOMM40L cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
927 bp
Description
Full length Clone DNA of Human translocase of outer mitochondrial membrane 40 homolog (yeast)-like with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TOMM40L cDNA ORF Clone, Human, N-His tag Alternative Names
TOMM40B cDNA ORF Clone, Human
TOMM40L Background Information
Full Name
translocase of outer mitochondrial membrane 40 homolog (yeast)-like

TOMM40L cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TOMM40L cDNA ORF Clone in Cloning Vector, Mouse MG52223-G
TOMM40L cDNA ORF Clone, Mouse, untagged MG52223-UT
TOMM40L Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52223-ACGLN
TOMM40L cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52223-ACG
TOMM40L cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52223-ANG
TOMM40L cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52223-ACR
TOMM40L cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52223-ANR
TOMM40L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52223-CF
TOMM40L cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52223-NF
TOMM40L cDNA ORF Clone, Mouse, C-His tag MG52223-CH
TOMM40L cDNA ORF Clone, Mouse, N-His tag MG52223-NH
TOMM40L cDNA ORF Clone, Mouse, C-HA tag MG52223-CY
TOMM40L cDNA ORF Clone, Mouse, N-HA tag MG52223-NY
TOMM40L cDNA ORF Clone, Mouse, C-Myc tag MG52223-CM
TOMM40L cDNA ORF Clone, Mouse, N-Myc tag MG52223-NM
TOMM40L qPCR Primer Pairs, Mouse MP202096

TOMM40L cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TOMM40L cDNA ORF Clone in Cloning Vector, Human HG15418-G
TOMM40L cDNA ORF Clone, Human, untagged HG15418-UT
TOMM40L Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15418-ACGLN
TOMM40L cDNA ORF Clone, Human, C-GFPSpark® tag HG15418-ACG
TOMM40L cDNA ORF Clone, Human, C-OFPSpark® tag HG15418-ACR
TOMM40L cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15418-CF
TOMM40L cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15418-NF
TOMM40L cDNA ORF Clone, Human, C-His tag HG15418-CH
TOMM40L cDNA ORF Clone, Human, C-HA tag HG15418-CY
TOMM40L cDNA ORF Clone, Human, N-HA tag HG15418-NY
TOMM40L cDNA ORF Clone, Human, C-Myc tag HG15418-CM
TOMM40L cDNA ORF Clone, Human, N-Myc tag HG15418-NM
TOMM40L qPCR Primer Pairs, Human HP104042
info info
添加购物车成功! 添加购物车失败!