TOM1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG15222-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TOM1 Reagents
CRO Services
Product recommended

All TOM1 Reagents
TOM1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1482 bp
Description
Full length Clone DNA of Human target of myb1 (chicken) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TOM1 Background Information
Full Name
target of myb1 membrane trafficking protein

TOM1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TOM1 cDNA ORF Clone in Cloning Vector, Mouse MG5A5077-U
TOM1 cDNA ORF Clone, Mouse, untagged MG5A5077-UT
TOM1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5077-ACG
TOM1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5077-ACGLN
TOM1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5077-ANG
TOM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5077-ACR
TOM1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5077-ANR
TOM1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5077-CF
TOM1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5077-NF
TOM1 cDNA ORF Clone, Mouse, C-His tag MG5A5077-CH
TOM1 cDNA ORF Clone, Mouse, N-His tag MG5A5077-NH
TOM1 cDNA ORF Clone, Mouse, C-HA tag MG5A5077-CY
TOM1 cDNA ORF Clone, Mouse, N-HA tag MG5A5077-NY
TOM1 cDNA ORF Clone, Mouse, C-Myc tag MG5A5077-CM
TOM1 cDNA ORF Clone, Mouse, N-Myc tag MG5A5077-NM

TOM1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TOM1 cDNA ORF Clone in Cloning Vector, Human HG15222-G
TOM1 cDNA ORF Clone, Human, untagged HG15222-UT
TOM1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15222-ACGLN
TOM1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15222-ACG
TOM1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15222-ANG
TOM1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15222-ACR
TOM1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15222-ANR
TOM1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15222-CF
TOM1 cDNA ORF Clone, Human, C-His tag HG15222-CH
TOM1 cDNA ORF Clone, Human, N-His tag HG15222-NH
TOM1 cDNA ORF Clone, Human, C-HA tag HG15222-CY
TOM1 cDNA ORF Clone, Human, N-HA tag HG15222-NY
TOM1 cDNA ORF Clone, Human, C-Myc tag HG15222-CM
TOM1 cDNA ORF Clone, Human, N-Myc tag HG15222-NM
TOM1 qPCR Primer Pairs, Human HP103848
info info
添加购物车成功! 添加购物车失败!