Troponin I cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11003-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Troponin I Reagents
CRO Services
Product recommended

All Troponin I Reagents
Troponin I cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
633 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human troponin I type 3 (cardiac) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.68kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Troponin I cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Troponin I cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human TNNI3 Gene Expression validated Image 1684
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Troponin I cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CMD1FF cDNA ORF Clone, Human;CMD2A cDNA ORF Clone, Human;CMH7 cDNA ORF Clone, Human;cTnI cDNA ORF Clone, Human;RCM1 cDNA ORF Clone, Human;TNNC1 cDNA ORF Clone, Human
Troponin I Background Information
Full Name
troponin I type 3 (cardiac)

Troponin I cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Troponin I cDNA ORF Clone in Cloning Vector, Rat RG82297-U
Troponin I Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82297-ACGLN

Troponin I cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Troponin I cDNA ORF Clone in Cloning Vector, Mouse MG53139-G
Troponin I cDNA ORF Clone, Mouse, untagged MG53139-UT
Troponin I Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53139-ACGLN
Troponin I cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53139-ACG
Troponin I cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53139-ANG
Troponin I cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53139-ACR
Troponin I cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53139-ANR
Troponin I cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53139-CF
Troponin I cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53139-NF
Troponin I cDNA ORF Clone, Mouse, C-His tag MG53139-CH
Troponin I cDNA ORF Clone, Mouse, N-His tag MG53139-NH
Troponin I cDNA ORF Clone, Mouse, C-HA tag MG53139-CY
Troponin I cDNA ORF Clone, Mouse, N-HA tag MG53139-NY
Troponin I cDNA ORF Clone, Mouse, C-Myc tag MG53139-CM
Troponin I cDNA ORF Clone, Mouse, N-Myc tag MG53139-NM

Troponin I cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Troponin I cDNA ORF Clone in Cloning Vector, Human HG11003-M
Troponin I cDNA ORF Clone, Human, untagged HG11003-UT
Troponin I cDNA ORF Clone, Human, C-GFPSpark® tag HG11003-ACG
Troponin I Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11003-ACGLN
Troponin I cDNA ORF Clone, Human, N-GFPSpark® tag HG11003-ANG
Troponin I cDNA ORF Clone, Human, C-OFPSpark® tag HG11003-ACR
Troponin I cDNA ORF Clone, Human, N-OFPSpark® tag HG11003-ANR
Troponin I cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11003-NF
Troponin I cDNA ORF Clone, Human, C-His tag HG11003-CH
Troponin I cDNA ORF Clone, Human, N-His tag HG11003-NH
Troponin I cDNA ORF Clone, Human, C-HA tag HG11003-CY
Troponin I cDNA ORF Clone, Human, N-HA tag HG11003-NY
Troponin I cDNA ORF Clone, Human, C-Myc tag HG11003-CM
Troponin I cDNA ORF Clone, Human, N-Myc tag HG11003-NM
Troponin I qPCR Primer Pairs, Human HP100965
info info
添加购物车成功! 添加购物车失败!