Troponin C cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11011-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Troponin C Reagents
CRO Services
Product recommended

All Troponin C Reagents
Troponin C cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
486 bp
Description
Full length Clone DNA of Human troponin C type 1 (slow) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Troponin C cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CMD1Z cDNA ORF Clone, Human;CMH13 cDNA ORF Clone, Human;TN-C cDNA ORF Clone, Human;TNC cDNA ORF Clone, Human;TNNC cDNA ORF Clone, Human
Troponin C Background Information

Troponin I, also known as TNNC1, is part of the troponin complex. This complex contains 3 subunits: troponin I (TnI), troponin T (TnT) and troponin C (TnC). Troponin I is the inhibitory subunit, blocking actin-myosin interactions and thereby mediating striated muscle relaxation. It binds to actin in thin myofilaments to hold the actin-tropomyosin complex in place. Because of it myosin cannot bind actin in relaxed muscle. When calcium binds to the Troponin C it causes conformational changes which lead to dislocation of troponin I and finally tropomyosin leaves the binding site for myosin on actin leading to contraction of muscle.

Full Name
troponin C type 1 (slow)
References
  • Kalaji FR. et al., 2012, Saudi J Kidney Dis Transpl. 23 (5): 939-45.
  • Wijnker PJ. et al., 2013, Am J Physiol Heart Circ Physiol. 304 (2): H260-8.
  • Solaro RJ. et al., 2013, Circ Res. 112 (2): 355-66.
  • Troponin C cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Troponin C cDNA ORF Clone in Cloning Vector, Mouse MG58646-U
    Troponin C cDNA ORF Clone, Mouse, untagged MG58646-UT
    Troponin C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58646-ACGLN
    Troponin C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58646-ACG
    Troponin C cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58646-ANG
    Troponin C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58646-ACR
    Troponin C cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58646-ANR
    Troponin C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58646-CF
    Troponin C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58646-NF
    Troponin C cDNA ORF Clone, Mouse, C-His tag MG58646-CH
    Troponin C cDNA ORF Clone, Mouse, N-His tag MG58646-NH
    Troponin C cDNA ORF Clone, Mouse, C-HA tag MG58646-CY
    Troponin C cDNA ORF Clone, Mouse, N-HA tag MG58646-NY
    Troponin C cDNA ORF Clone, Mouse, C-Myc tag MG58646-CM
    Troponin C cDNA ORF Clone, Mouse, N-Myc tag MG58646-NM

    Troponin C cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Troponin C cDNA ORF Clone in Cloning Vector, Human HG11011-M
    Troponin C cDNA ORF Clone, Human, untagged HG11011-UT
    Troponin C cDNA ORF Clone, Human, C-GFPSpark® tag HG11011-ACG
    Troponin C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11011-ACGLN
    Troponin C cDNA ORF Clone, Human, N-GFPSpark® tag HG11011-ANG
    Troponin C cDNA ORF Clone, Human, C-OFPSpark® tag HG11011-ACR
    Troponin C cDNA ORF Clone, Human, N-OFPSpark® tag HG11011-ANR
    Troponin C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11011-NF
    Troponin C cDNA ORF Clone, Human, C-His tag HG11011-CH
    Troponin C cDNA ORF Clone, Human, N-His tag HG11011-NH
    Troponin C cDNA ORF Clone, Human, C-HA tag HG11011-CY
    Troponin C cDNA ORF Clone, Human, N-HA tag HG11011-NY
    Troponin C cDNA ORF Clone, Human, C-Myc tag HG11011-CM
    Troponin C cDNA ORF Clone, Human, N-Myc tag HG11011-NM
    Troponin C qPCR Primer Pairs, Human HP100973
    info info
    添加购物车成功! 添加购物车失败!