4-1BBL cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15693-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All 4-1BBL Reagents
CRO Services
Product recommended

All 4-1BBL Reagents
4-1BBL cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
804 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 9 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI(6kb+0.80kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
4-1BBL cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

4-1BBL cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
4-1BBL cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
4-1BB-L cDNA ORF Clone, Human;4-1BBL cDNA ORF Clone, Human;CD137L cDNA ORF Clone, Human
4-1BBL Background Information

4-1BBL is the high affinity ligand of 4-1BB, also known as CD137L or TNFSF9. It is shown to be a type II surface glycoprotein belonging to the TNF superfamily. Expression of 4-1BBL is restricted to APCs, such as dendritic cells, macrophages, and activated B cells. Members of the TNF-TNF receptor superfamily have been shown to play critical roles in regulating cellular activation, differentiation and apoptosis. Several studies have reported that 4-1BBL/4-1BB interaction provided a co-stimulatory signal to T cells, and increased T cell proliferation and cytokines production. In additon, 4-1BBL is involved in cancers, infectious diseases and autoimmune diseases.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: FCM Antibodies
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
tumor necrosis factor (ligand) superfamily, member 9
References
  • Cheung CT, (2007) Neutralizing anti-4-1BBL treatment improves cardiac function in viral myocarditis. Lab Invest. 87(7): 651-61.
  • Wang C, et al. (2009) Immune regulation by 4-1BB and 4-1BBL: complexities and challenges. Immunol Rev. 229(1): 192-215.
  • Habib-Agahi M, et al. (2009) 4-1BBL costimulation retrieves CD28 expression in activated T cells. Cell Immunol. 256(1-2): 39-46.
  • 4-1BBL cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    4-1BBL cDNA ORF Clone in Cloning Vector, Cynomolgus CG90848-G

    4-1BBL cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    4-1BBL cDNA ORF Clone, Rat, C-GFPSpark® tag RG80166-ACG
    4-1BBL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80166-ACGLN
    4-1BBL cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80166-CF
    4-1BBL cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80166-NF

    4-1BBL cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    4-1BBL cDNA ORF Clone in Cloning Vector, Mouse MG50067-M
    4-1BBL cDNA ORF Clone, Mouse, untagged MG50067-UT
    4-1BBL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50067-ACGLN
    4-1BBL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50067-ACG
    4-1BBL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50067-ACR
    4-1BBL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50067-CF
    4-1BBL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50067-NF
    4-1BBL cDNA ORF Clone, Mouse, C-His tag MG50067-CH
    4-1BBL cDNA ORF Clone, Mouse, N-His tag MG50067-NH
    4-1BBL cDNA ORF Clone, Mouse, C-HA tag MG50067-CY
    4-1BBL cDNA ORF Clone, Mouse, N-HA tag MG50067-NY
    4-1BBL cDNA ORF Clone, Mouse, C-Myc tag MG50067-CM
    4-1BBL cDNA ORF Clone, Mouse, N-Myc tag MG50067-NM
    4-1BBL qPCR Primer Pairs, Mouse MP200098

    4-1BBL cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    4-1BBL cDNA ORF Clone in Cloning Vector, Human HG15693-G
    4-1BBL cDNA ORF Clone, Human, untagged HG15693-UT
    4-1BBL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15693-ACGLN
    4-1BBL cDNA ORF Clone, Human, C-GFPSpark® tag HG15693-ACG
    4-1BBL cDNA ORF Clone, Human, C-OFPSpark® tag HG15693-ACR
    4-1BBL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15693-NF
    4-1BBL cDNA ORF Clone, Human, C-His tag HG15693-CH
    4-1BBL cDNA ORF Clone, Human, N-His tag HG15693-NH
    4-1BBL cDNA ORF Clone, Human, C-HA tag HG15693-CY
    4-1BBL cDNA ORF Clone, Human, N-HA tag HG15693-NY
    4-1BBL cDNA ORF Clone, Human, C-Myc tag HG15693-CM
    4-1BBL cDNA ORF Clone, Human, N-Myc tag HG15693-NM
    info info
    添加购物车成功! 添加购物车失败!