After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CD137L/4-1BBL/TNFSF9 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human TNFSF9 cDNA Clone Product Information
NCBI RefSeq:NM_003811.3
RefSeq ORF Size:765bp
cDNA Description:Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 9 with C terminal Flag tag.
Gene Synonym:CD137L, 4-1BB-L
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
????��??????3?o?MG53720???������?o��?????o?????????��?����??���䡧?2??????�㨨���?1????������?��????????��????����騨���???
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

4-1BBL is the high affinity ligand of 4-1BB, also known as CD137L or TNFSF9. It is shown to be a type II surface glycoprotein belonging to the TNF superfamily. Expression of 4-1BBL is restricted to APCs, such as dendritic cells, macrophages, and activated B cells. Members of the TNF-TNF receptor superfamily have been shown to play critical roles in regulating cellular activation, differentiation and apoptosis. Several studies have reported that 4-1BBL/4-1BB interaction provided a co-stimulatory signal to T cells, and increased T cell proliferation and cytokines production. In additon, 4-1BBL is involved in cancers, infectious diseases and autoimmune diseases.

References
  • Cheung CT, (2007) Neutralizing anti-4-1BBL treatment improves cardiac function in viral myocarditis. Lab Invest. 87(7): 651-61.
  • Wang C, et al. (2009) Immune regulation by 4-1BB and 4-1BBL: complexities and challenges. Immunol Rev. 229(1): 192-215.
  • Habib-Agahi M, et al. (2009) 4-1BBL costimulation retrieves CD28 expression in activated T cells. Cell Immunol. 256(1-2): 39-46.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"