After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human OX-40L / TNFSF4 / CD252 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human TNFSF4 cDNA Clone Product Information
NCBI RefSeq:NM_003326.3
RefSeq ORF Size:552bp
cDNA Description:Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 4 with N terminal His tag.
Gene Synonym:GP34, CD252, OX4OL, TXGP1, CD134L, OX-40L, TNFSF4
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-TNFSF4
Restriction Site:KpnI + XbaI (6kb + 0.64kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human TNFSF4 Gene Plasmid Map
Human TNFSF4 ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

OX-40L, also known as TNFSF4 and CD252, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. OX-40L is an important costimulatory molecule that plays a crucial role in the regulation of T-cell-mediated immunity. The interaction of TNFSF4-TNFSF4 is involved in the pathogenesis of multiple autoimmune and inflammatory diseases such as systemic lupus erythematosus (SLE), carotid artery disease and cancer. OX-40L is a ligand for receptor TNFRSF4/OX4. It is found to play a role in T cell antigen-presenting cell (APC) interactions. In surface Ig- and CD40-stimulated B cells, this cytokine along with CD70 has been shown to provide CD28-independent costimulatory signals to T cells. This protein and its receptor are reported to directly mediate adhesion of activated T cells to vascular endothelial cells.

References
  • Lei W. et al., 2012, Ann Acad Med Singapore. 41 (5): 200-4.
  • Lee YH. et al., 2012, Hum Immunol. 73 (10): 1050-4.
  • Weiguang Y. et al., 2012, PLoS One. 7 (8): e41277.
  • Size / Price
    Catalog: HG13127-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human TNFSF4 ORF mammalian expression plasmid, N-His tag
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"