Quick Order

Human TNFSF13 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human TNFSF13 cDNA Clone Product Information
NCBI RefSeq:NM_003808.3
RefSeq ORF Size:753bp
cDNA Description:Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 13 with N terminal HA tag.
Gene Synonym:APRIL, CD256, TALL2, TRDL-1, ligand, UNQ383/PRO715
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

TNFSF13 is a member of the tumor necrosis factor (TNF) ligand family. It is a ligand for TNFRSF17/BCMA. TNFSF13 is lowly expressed in normal tissues, but is elevated in several types of tumors and transformed cell lines. It is mportant for B cell development. TNFSF13 may also play a role in T-independent type II antigen responses and T cell survival, and induce proliferation/survival of non lymphoid cells. It exists as a functional homotrimer. It can bind to two cell surface receptors, BCMA and TACI, which it shares with BAFF to exert downstream T- and B-cell regulatory effects. TNFSF13 also has been demonstrated to bind to proteoglycans on the cell surface.

References
  • Bossen C, et al. (2007) BAFF, APRIL and their receptors: structure, function and signaling. Semin. Immunol. 18(5):263-75.
  • Tangye SG, et al. (2007) BAFF, APRIL and human B cell disorders. Immunol. 18(5): 305-17.
  • Osman W, et al. (2012) Association of common variants in TNFRSF13B, TNFSF13, and ANXA3 with serum levels of non-albumin protein and immunoglobulin isotypes in Japanese. PLoS One. 7(4):e32683.
  • Size / Price
    Catalog: HG10610-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"