OX40 cDNA ORF Clone, Human, C-His tag

Cat: HG10481-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All OX40 Reagents
CRO Services
Product recommended

All OX40 Reagents
OX40 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
834 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 534G/A not causing the amino acid variation.
Description
Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 4 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + XbaI (6kb + 0.88kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
OX40 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OX40 cDNA ORF Clone, Human, C-His tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5610
OX40 cDNA ORF Clone, Human, C-His tag Alternative Names
ACT35 cDNA ORF Clone, Human;CD134 cDNA ORF Clone, Human;IMD16 cDNA ORF Clone, Human;OX40 cDNA ORF Clone, Human;TXGP1L cDNA ORF Clone, Human
OX40 Background Information

OX40 (CD134) and its binding partner, OX40L (CD252), are members of the tumor necrosis factor receptor/tumor necrosis factor superfamily, is known to break an existing state of tolerance in malignancies, leading to a reactivation of antitumor immunity. The interaction between OX40 and OX40L plays an important role in antigen-specific T-cell expansion and survival. OX40 and OX40L also regulate cytokine production from T cells, antigen-presenting cells, natural killer cells, and natural killer T cells, and modulate cytokine receptor signaling. In line with these important modulatory functions, OX40-OX40L interactions have been found to play a central role in the development of multiple inflammatory and autoimmune diseases, making them attractive candidates for intervention in the clinic. Conversely, stimulating OX40 has shown it to be a candidate for therapeutic immunization strategies for cancer and infectious disease.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
tumor necrosis factor receptor superfamily, member 4
References
  • Compaan D.M., et al. (2006) .The crystal structure of the costimulatory OX40-OX40L complex. Structure 14:1321-1330.
  • Kawamata S., et al. (1998) .Activation of OX40 signal transduction pathways leads to tumor necrosis factor receptor-associated factor (TRAF) 2- and TRAF5-mediated NF-kappaB activation. J. Biol. Chem. 273:5808-5814.
  • Byun M., (2013) Inherited human OX40 deficiency underlying classic Kaposi sarcoma of childhood. J. Exp. Med. 210:1743-1759.
  • OX40 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    OX40 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90873-G
    OX40 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90846-G
    OX40 cDNA ORF Clone, Cynomolgus, untagged CG90846-UT
    OX40 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90846-ACGLN
    OX40 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90846-ACG
    OX40 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90846-ACR
    OX40 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90846-CF
    OX40 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90846-NF
    OX40 cDNA ORF Clone, Cynomolgus, C-His tag CG90846-CH
    OX40 cDNA ORF Clone, Cynomolgus, N-His tag CG90846-NH
    OX40 cDNA ORF Clone, Cynomolgus, C-HA tag CG90846-CY
    OX40 cDNA ORF Clone, Cynomolgus, N-HA tag CG90846-NY
    OX40 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90846-CM
    OX40 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90846-NM

    OX40 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    OX40 cDNA ORF Clone, Rat, untagged RG84472-UT
    OX40 cDNA ORF Clone, Rat, C-GFPSpark® tag RG84472-ACG
    OX40 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84472-ACGLN
    OX40 cDNA ORF Clone, Rat, C-OFPSpark® tag RG84472-ACR
    OX40 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG84472-CF
    OX40 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG84472-NF
    OX40 cDNA ORF Clone, Rat, C-His tag RG84472-CH
    OX40 cDNA ORF Clone, Rat, N-His tag RG84472-NH
    OX40 cDNA ORF Clone, Rat, C-HA tag RG84472-CY
    OX40 cDNA ORF Clone, Rat, N-HA tag RG84472-NY
    OX40 cDNA ORF Clone, Rat, C-Myc tag RG84472-CM
    OX40 cDNA ORF Clone, Rat, N-Myc tag RG84472-NM

    OX40 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    OX40 cDNA ORF Clone in Cloning Vector, Mouse MG50808-G
    OX40 cDNA ORF Clone, Mouse, untagged MG50808-UT
    OX40 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50808-ACGLN
    OX40 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50808-ACG
    OX40 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50808-ACR
    OX40 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50808-CF
    OX40 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50808-NF
    OX40 cDNA ORF Clone, Mouse, C-His tag MG50808-CH
    OX40 cDNA ORF Clone, Mouse, N-His tag MG50808-NH
    OX40 cDNA ORF Clone, Mouse, C-HA tag MG50808-CY
    OX40 cDNA ORF Clone, Mouse, N-HA tag MG50808-NY
    OX40 cDNA ORF Clone, Mouse, C-Myc tag MG50808-CM
    OX40 cDNA ORF Clone, Mouse, N-Myc tag MG50808-NM
    OX40 qPCR Primer Pairs, Mouse MP200779

    OX40 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    OX40 cDNA ORF Clone in Cloning Vector, Human HG10481-G
    OX40 cDNA ORF Clone, Human, untagged HG10481-UT
    OX40 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10481-ACGLN
    OX40 cDNA ORF Clone, Human, C-GFPSpark® tag HG10481-ACG
    OX40 cDNA ORF Clone, Human, C-OFPSpark® tag HG10481-ACR
    OX40 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10481-CF
    OX40 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10481-NF
    OX40 cDNA ORF Clone, Human, N-His tag HG10481-NH
    OX40 cDNA ORF Clone, Human, C-HA tag HG10481-CY
    OX40 cDNA ORF Clone, Human, N-HA tag HG10481-NY
    OX40 cDNA ORF Clone, Human, C-Myc tag HG10481-CM
    OX40 cDNA ORF Clone, Human, N-Myc tag HG10481-NM
    OX40 qPCR Primer Pairs, Human HP100503
    info info
    添加购物车成功! 添加购物车失败!