DR3 cDNA ORF Clone, Human, C-His tag

Cat: HG12095-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DR3 Reagents
CRO Services
Product recommended

All DR3 Reagents
DR3 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1254 bp
Description
Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 25 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DR3 cDNA ORF Clone, Human, C-His tag Alternative Names
APO-3 cDNA ORF Clone, Human;DDR3 cDNA ORF Clone, Human;DR3 cDNA ORF Clone, Human;LARD cDNA ORF Clone, Human;TNFRSF12 cDNA ORF Clone, Human;TR3 cDNA ORF Clone, Human;TRAMP cDNA ORF Clone, Human;WSL-1 cDNA ORF Clone, Human;WSL-LR cDNA ORF Clone, Human
DR3 Background Information

Tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), also known as Death receptor 3 (DR3) or TNFRSF12 is a member of the TNF-receptor superfamily. This receptor is expressed preferentially in the tissues enriched in lymphocytes, and it may play a role in regulating lymphocyte homeostasis. TNFRSF25/DR3/TNFRSF12 has been shown to stimulate NF-kappa B activity and regulate cell apoptosis. The signal transduction of this receptor is mediated by various death domain containing adaptor proteins. Knockout studies in mice suggested the role of this gene in the removal of self-reactive T cells in the thymus. Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported, most of which are potentially secreted molecules. The alternative splicing of this TNFRSF25 encoding gene in B and T cells encounters a programmed change upon T-cell activation, which predominantly produces full-length, membrane bound isoforms, and is thought to be involved in controlling lymphocyte proliferation induced by T-cell activation.

Full Name
tumor necrosis factor receptor superfamily, member 25
References
  • Slebioda TJ, et al. (2011) Triggering of TNFRSF25 promotes CD8? T-cell responses and anti-tumor immunity. Eur J Immunol. 41(9): 606-11.
  • Fang L, et al. (2008) Essential role of TNF receptor superfamily 25 (TNFRSF25) in the development of allergic lung inflammation. J Exp Med. 205(5): 037-48.
  • Borysenko CW, et al. (2005) Comparative modeling of TNFRSF25 (DR3) predicts receptor destabilization by a mutation linked to rheumatoid arthritis. Biochem Biophys Res Commun. 328(3): 94-9.
  • info info
    添加购物车成功! 添加购物车失败!