Quick Order

Human TNFRSF25/DR3/TNFRSF12 Gene ORF cDNA clone expression plasmid, C-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Human TNFRSF25 cDNA Clone Product Information
    NCBI RefSeq:NM_148965
    RefSeq ORF Size:1254bp
    cDNA Description:Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 25 with C terminal Flag tag.
    Gene Synonym:DR3, TRAMP, WSL-1, LARD, WSL-LR, DDR3, TR3, APO-3
    Species:Human
    Vector:pCMV3-C-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TNFRSF25 qPCR primers for gene expression analysis, HP101623 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    Tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), also known as Death receptor 3 (DR3) or TNFRSF12 is a member of the TNF-receptor superfamily. This receptor is expressed preferentially in the tissues enriched in lymphocytes, and it may play a role in regulating lymphocyte homeostasis. TNFRSF25/DR3/TNFRSF12 has been shown to stimulate NF-kappa B activity and regulate cell apoptosis. The signal transduction of this receptor is mediated by various death domain containing adaptor proteins. Knockout studies in mice suggested the role of this gene in the removal of self-reactive T cells in the thymus. Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported, most of which are potentially secreted molecules. The alternative splicing of this TNFRSF25 encoding gene in B and T cells encounters a programmed change upon T-cell activation, which predominantly produces full-length, membrane bound isoforms, and is thought to be involved in controlling lymphocyte proliferation induced by T-cell activation.

    References
  • Slebioda TJ, et al. (2011) Triggering of TNFRSF25 promotes CD8? T-cell responses and anti-tumor immunity. Eur J Immunol. 41(9): 606-11.
  • Fang L, et al. (2008) Essential role of TNF receptor superfamily 25 (TNFRSF25) in the development of allergic lung inflammation. J Exp Med. 205(5): 037-48.
  • Borysenko CW, et al. (2005) Comparative modeling of TNFRSF25 (DR3) predicts receptor destabilization by a mutation linked to rheumatoid arthritis. Biochem Biophys Res Commun. 328(3): 94-9.
  • Size / Price
    Catalog: HG12095-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"