Quick Order

Human BAFFR / TNFRSF13C / CD268 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human TNFRSF13C cDNA Clone Product Information
NCBI RefSeq:NM_052945.3
RefSeq ORF Size:555bp
cDNA Description:Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 13C with N terminal His tag.
Gene Synonym:BAFFR, CD268, CVID4, BAFF-R, BROMIX, prolixin
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C) also known as B-cell-activating factor receptor (BAFFR) and CD268 antigen, is a member of the tumor necrosis factor receptor superfamily. A tumor necrosis factor receptor (TNFR), or death receptor, is a trimeric cytokine receptor that binds tumor necrosis factors (TNF). The receptor cooperates with an adaptor protein which is important in determining the outcome of the response. Members of the TNF receptor superfamily (TNFRSF) have crucial roles in both innate and adaptive immunity and in cellular apoptosis process. Apoptosis is a cell suicide mechanism that enables metazoans to control cell number in tissues and to eliminate individual cells that threaten the animal's survival. Certain cells have unique sensors, termed death receptors or tumour necrosis factor (TNFR), on their surface. Tumour necrosis factors (TNFR) detect the presence of extracellular death signals and, in response, they rapidly ignite the cell's intrinsic apoptosis machinery. It has been proposed that abnormally high levels of BAFFR/TNFRSF13C (CD268) may contribute to the pathogenesis of autoimmune diseases by enhancing the survival of autoreactive B cells.

References
  • Ashkenazi A, et al. (1998) Death receptors: signaling and modulation. Science. 281(5381): 1305-8.
  • Losi CG, et al. (2005) Mutational analysis of human BAFF receptor TNFRSF13C (BAFF-R) in patients with common variable immunodeficiency. J Clin Immunol. 25(5): 496-502.
  • Hentges KE, et al. (2002) Tnfrsf13c (Baffr) is mis-expressed in tumors with murine leukemia virus insertions at Lvis22. Genomics. 80(2): 204-12.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"