Quick Order

Text Size:AAA

Human TNFAIP3 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human TNFAIP3 cDNA Clone Product Information
NCBI RefSeq:NM_006290.2
RefSeq ORF Size:2373bp
cDNA Description:Full length Clone DNA of Homo sapiens tumor necrosis factor, alpha-induced protein 3.
Gene Synonym:A20, OTUD7C, TNFA1P2, MGC104522, MGC138687, MGC138688, TNFAIP3
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-TNFAIP3
Restriction Site:KpnI + XbaI (6.1kb + 2.37kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human TNFAIP3 Gene Plasmid Map
Human TNFAIP3 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG12089-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human TNFAIP3 natural ORF mammalian expression plasmid
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"