TNFAIP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14716-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TNFAIP1 Reagents
CRO Services
Product recommended

All TNFAIP1 Reagents
TNFAIP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
951 bp
Description
Full length Clone DNA of Human tumor necrosis factor, alpha-induced protein 1 (endothelial) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TNFAIP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
B12 cDNA ORF Clone, Human;B61 cDNA ORF Clone, Human;BTBD34 cDNA ORF Clone, Human;EDP1 cDNA ORF Clone, Human;hBACURD2 cDNA ORF Clone, Human
TNFAIP1 Background Information
Full Name
tumor necrosis factor, alpha-induced protein 1 (endothelial)

TNFAIP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TNFAIP1 cDNA ORF Clone in Cloning Vector, Mouse MG53925-U
TNFAIP1 cDNA ORF Clone, Mouse, untagged MG53925-UT
TNFAIP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53925-ACG
TNFAIP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53925-ACGLN
TNFAIP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53925-ANG
TNFAIP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53925-ACR
TNFAIP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53925-ANR
TNFAIP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53925-CF
TNFAIP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53925-NF
TNFAIP1 cDNA ORF Clone, Mouse, C-His tag MG53925-CH
TNFAIP1 cDNA ORF Clone, Mouse, N-His tag MG53925-NH
TNFAIP1 cDNA ORF Clone, Mouse, C-HA tag MG53925-CY
TNFAIP1 cDNA ORF Clone, Mouse, N-HA tag MG53925-NY
TNFAIP1 cDNA ORF Clone, Mouse, C-Myc tag MG53925-CM
TNFAIP1 cDNA ORF Clone, Mouse, N-Myc tag MG53925-NM

TNFAIP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TNFAIP1 cDNA ORF Clone in Cloning Vector, Human HG14716-G
TNFAIP1 cDNA ORF Clone, Human, untagged HG14716-UT
TNFAIP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14716-ACG
TNFAIP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14716-ACGLN
TNFAIP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14716-ANG
TNFAIP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14716-ACR
TNFAIP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14716-ANR
TNFAIP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14716-CF
TNFAIP1 cDNA ORF Clone, Human, C-His tag HG14716-CH
TNFAIP1 cDNA ORF Clone, Human, N-His tag HG14716-NH
TNFAIP1 cDNA ORF Clone, Human, C-HA tag HG14716-CY
TNFAIP1 cDNA ORF Clone, Human, N-HA tag HG14716-NY
TNFAIP1 cDNA ORF Clone, Human, C-Myc tag HG14716-CM
TNFAIP1 cDNA ORF Clone, Human, N-Myc tag HG14716-NM
TNFAIP1 qPCR Primer Pairs, Human HP103350
info info
添加购物车成功! 添加购物车失败!