Quick Order

Human TNF-alpha/TNFA/TNFSF2 Gene ORF cDNA clone expression plasmid, C-His tag

  • Human TNFα Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
DatasheetReviewsRelated ProductsProtocols
Human TNF cDNA Clone Product Information
NCBI RefSeq:NM_000594.2
RefSeq ORF Size:702bp
cDNA Description:Full length Clone DNA of Homo sapiens tumor necrosis factor (TNF superfamily, member 2) with C terminal His tag.
Gene Synonym:DIF, TNFA, TNFSF2, TNF-alpha, TNF
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-TNF-His
Restriction Site:KpnI + XbaI (6kb + 0.75kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with TNF qPCR primers for gene expression analysis, HP100592 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human TNF Gene Plasmid Map
Human TNFα Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Tumor necrosis factor alpha (TNF-alpha), also known as TNF, TNFA or TNFSF2, is the prototypic cytokine of the TNF superfamily, and is a multifunctional molecule involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. Two receptors, TNF-R1 (TNF receptor type 1; CD120a; p55/60) and TNF-R2 (TNF receptor type 2; CD120b; p75/80), bind to TNF-alpha. TNF-alpha protein is produced mainly by macrophages, and large amounts of this cytokine are released in response to lipopolysaccharide, other bacterial products, and Interleukin-1 (IL-1). TNF-alpha is involved in fighting against the tumorigenesis, thus, is regarded as a molecular insight in cancer treatment.

TNF-alpha Protein & Antibody

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Hector J, et al. (2007) TNF-alpha alters visfatin and adiponectin levels in human fat. Horm Metab Res. 39(4): 250-5.
  • Berthold-Losleben M, et al. (2008) The TNF-alpha System: Functional Aspects in Depression, Narcolepsy and Psychopharmacology. Curr Neuropharmacol. 6(3): 193-202.
  • Size / Price
    Catalog: HG10602-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"