TMIGD2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG15525-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMIGD2 Reagents
CRO Services
Product recommended

All TMIGD2 Reagents
TMIGD2 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
849 bp
Description
Full length Clone DNA of Human transmembrane and immunoglobulin domain containing 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMIGD2 cDNA ORF Clone, Human, N-Myc tag Alternative Names
IGPR-1 cDNA ORF Clone, Human;IGPR1 cDNA ORF Clone, Human;TMIGD2 cDNA ORF Clone, Human
TMIGD2 Background Information

The orthologue of human IGPR-1 is found only in eukaryotes, including primates, the guinea pig, canines, felines, dolphins, bovines, the llama, bats, the common shrew, and horses. Of interest, the IGPR-1 gene is absent in mouse and rat genomes. The immunoglobulin domain of IGPR-1 was predicted to be Ig V (variable) fold and was found to be highly similar to the Ig domain of myelin-associated glycoprotein.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
transmembrane and immunoglobulin domain containing 2
References
  • Rahimi N, Rezazadeh K, Mahoney JE, Hartsough E, Meyer RD. Identification of IGPR-1 as a novel adhesion molecule involved in angiogenesis. Nusrat A, ed. Molecular Biology of the Cell. 2012;23(9):1646-1656.
  • TMIGD2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TMIGD2 cDNA ORF Clone in Cloning Vector, Human HG13820-G
    TMIGD2 cDNA ORF Clone in Cloning Vector, Human HG13819-G
    TMIGD2 cDNA ORF Clone in Cloning Vector, Human HG15525-G
    TMIGD2 cDNA ORF Clone, Human, untagged HG15525-UT
    TMIGD2 cDNA ORF Clone, Human, untagged HG13819-UT
    TMIGD2 cDNA ORF Clone, Human, untagged HG13820-UT
    TMIGD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13819-ACG
    TMIGD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15525-ACG
    TMIGD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13819-ACGLN
    TMIGD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13820-ACGLN
    TMIGD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13820-ACG
    TMIGD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15525-ACGLN
    TMIGD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13820-ACR
    TMIGD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15525-ACR
    TMIGD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13819-ACR
    TMIGD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15525-CF
    TMIGD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13819-CF
    TMIGD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13820-CF
    TMIGD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13819-NF
    TMIGD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13820-NF
    TMIGD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15525-NF
    TMIGD2 cDNA ORF Clone, Human, C-His tag HG13820-CH
    TMIGD2 cDNA ORF Clone, Human, C-His tag HG15525-CH
    TMIGD2 cDNA ORF Clone, Human, C-His tag HG13819-CH
    TMIGD2 cDNA ORF Clone, Human, N-His tag HG13820-NH
    TMIGD2 cDNA ORF Clone, Human, N-His tag HG13819-NH
    TMIGD2 cDNA ORF Clone, Human, N-His tag HG15525-NH
    TMIGD2 cDNA ORF Clone, Human, C-HA tag HG15525-CY
    TMIGD2 cDNA ORF Clone, Human, C-HA tag HG13819-CY
    TMIGD2 cDNA ORF Clone, Human, C-HA tag HG13820-CY
    TMIGD2 cDNA ORF Clone, Human, N-HA tag HG13820-NY
    TMIGD2 cDNA ORF Clone, Human, N-HA tag HG15525-NY
    TMIGD2 cDNA ORF Clone, Human, N-HA tag HG13819-NY
    TMIGD2 cDNA ORF Clone, Human, C-Myc tag HG13819-CM
    TMIGD2 cDNA ORF Clone, Human, C-Myc tag HG15525-CM
    TMIGD2 cDNA ORF Clone, Human, C-Myc tag HG13820-CM
    TMIGD2 cDNA ORF Clone, Human, N-Myc tag HG13819-NM
    TMIGD2 cDNA ORF Clone, Human, N-Myc tag HG13820-NM
    TMIGD2 qPCR Primer Pairs, Human HP102492
    info info
    添加购物车成功! 添加购物车失败!