Quick Order

Human TMIGD2/IGPR-1 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human TMIGD2 cDNA Clone Product Information
    NCBI RefSeq:BC015655
    RefSeq ORF Size:849bp
    cDNA Description:Full length Clone DNA of Homo sapiens transmembrane and immunoglobulin domain containing 2.
    Gene Synonym:IGPR1, IGPR-1
    Species:Human
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TMIGD2 qPCR primers for gene expression analysis, HP102492 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    The orthologue of human IGPR-1 is found only in eukaryotes, including primates, the guinea pig, canines, felines, dolphins, bovines, the llama, bats, the common shrew, and horses. Of interest, the IGPR-1 gene is absent in mouse and rat genomes. The immunoglobulin domain of IGPR-1 was predicted to be Ig V (variable) fold and was found to be highly similar to the Ig domain of myelin-associated glycoprotein.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Rahimi N, Rezazadeh K, Mahoney JE, Hartsough E, Meyer RD. Identification of IGPR-1 as a novel adhesion molecule involved in angiogenesis. Nusrat A, ed. Molecular Biology of the Cell. 2012;23(9):1646-1656.
  • Size / Price
    Catalog: HG15525-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"