Quick Order

Human TMIGD2/IGPR-1 Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human TMIGD2 cDNA Clone Product Information
    NCBI RefSeq:BC015655
    RefSeq ORF Size:849bp
    cDNA Description:Full length Clone DNA of Homo sapiens transmembrane and immunoglobulin domain containing 2 with N terminal His tag.
    Gene Synonym:IGPR1, IGPR-1
    Species:Human
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TMIGD2 qPCR primers for gene expression analysis, HP102492 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    The orthologue of human IGPR-1 is found only in eukaryotes, including primates, the guinea pig, canines, felines, dolphins, bovines, the llama, bats, the common shrew, and horses. Of interest, the IGPR-1 gene is absent in mouse and rat genomes. The immunoglobulin domain of IGPR-1 was predicted to be Ig V (variable) fold and was found to be highly similar to the Ig domain of myelin-associated glycoprotein.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Rahimi N, Rezazadeh K, Mahoney JE, Hartsough E, Meyer RD. Identification of IGPR-1 as a novel adhesion molecule involved in angiogenesis. Nusrat A, ed. Molecular Biology of the Cell. 2012;23(9):1646-1656.
  • Size / Price
    Catalog: HG15525-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"