TMEM5 cDNA ORF Clone, Human, C-His tag

Cat: HG16419-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMEM5 Reagents
CRO Services
Product recommended

All TMEM5 Reagents
TMEM5 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
552 bp
Description
Full length Clone DNA of Human transmembrane protein 5 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM5 cDNA ORF Clone, Human, C-His tag Alternative Names
HP10481 cDNA ORF Clone, Human;MDDGA10 cDNA ORF Clone, Human
TMEM5 Background Information
Full Name
transmembrane protein 5

TMEM5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM5 cDNA ORF Clone in Cloning Vector, Mouse MG5A6022-U
TMEM5 cDNA ORF Clone, Mouse, untagged MG5A6022-UT
TMEM5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6022-ACGLN
TMEM5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6022-ACG
TMEM5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A6022-ANG
TMEM5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A6022-ACR
TMEM5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A6022-ANR
TMEM5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A6022-CF
TMEM5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A6022-NF
TMEM5 cDNA ORF Clone, Mouse, C-His tag MG5A6022-CH
TMEM5 cDNA ORF Clone, Mouse, N-His tag MG5A6022-NH
TMEM5 cDNA ORF Clone, Mouse, C-HA tag MG5A6022-CY
TMEM5 cDNA ORF Clone, Mouse, N-HA tag MG5A6022-NY
TMEM5 cDNA ORF Clone, Mouse, C-Myc tag MG5A6022-CM
TMEM5 cDNA ORF Clone, Mouse, N-Myc tag MG5A6022-NM

TMEM5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM5 cDNA ORF Clone in Cloning Vector, Human HG16419-G
TMEM5 cDNA ORF Clone, Human, untagged HG16419-UT
TMEM5 cDNA ORF Clone, Human, C-GFPSpark® tag HG16419-ACG
TMEM5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16419-ACGLN
TMEM5 cDNA ORF Clone, Human, C-OFPSpark® tag HG16419-ACR
TMEM5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16419-CF
TMEM5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16419-NF
TMEM5 cDNA ORF Clone, Human, N-His tag HG16419-NH
TMEM5 cDNA ORF Clone, Human, C-HA tag HG16419-CY
TMEM5 cDNA ORF Clone, Human, N-HA tag HG16419-NY
TMEM5 cDNA ORF Clone, Human, C-Myc tag HG16419-CM
TMEM5 cDNA ORF Clone, Human, N-Myc tag HG16419-NM
TMEM5 qPCR Primer Pairs, Human HP105168
info info
添加购物车成功! 添加购物车失败!