Quick Order

Human TMEM27 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human TMEM27 cDNA Clone Product Information
    NCBI RefSeq:BC014317
    RefSeq ORF Size:669bp
    cDNA Description:Full length Clone DNA of Homo sapiens transmembrane protein 27.
    Gene Synonym:NX17, NX-17, TMEM27
    Species:Human
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TMEM27 qPCR primers for gene expression analysis, HP102009 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    TMEM27 is a membrane protein. It has been proposed as a beta cell mass biomarker since it is cleaved and shed by pancreatic beta cells. Overexpression of TMEM27 leads to increased thymidine incorporation, whereas silencing of Tmem27 using RNAi results in a reduction of cell replication. Furthermore, transgenic mice with increased expression of Tmem27 in pancreatic beta cells exhibit increased beta cell mass. TMEM27 is also important for trafficking amino acid transporters to the apical brush border of proximal tubules.

    References
  • Pasquali L, et al. (2009) Collectrin gene screening in Turner syndrome patients with kidney malformation. J Genet. 88(1):105-8.
  • Tosetto E, et al. (2009) Locus heterogeneity of Dent's disease: OCRL1 and TMEM27 genes in patients with no CLCN5 mutations. Pediatr Nephrol. 24(10):1967-73.
  • Singer D, et al. (2011) Collectrin and ACE2 in renal and intestinal amino acid transport. Channels (Austin). 5(5):410-23.
  • Size / Price
    Catalog: HG13301-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"