TMEM199 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG13417-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TMEM199 Reagents
CRO Services
Product recommended

All TMEM199 Reagents
TMEM199 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
627 bp
Description
Full length Clone DNA of Human transmembrane protein 199 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM199 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
C17orf32 cDNA ORF Clone, Human
TMEM199 Background Information
Full Name
transmembrane protein 199

TMEM199 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TMEM199 cDNA ORF Clone in Cloning Vector, Rat RG8A0041-U
TMEM199 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0041-ACGLN

TMEM199 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM199 cDNA ORF Clone in Cloning Vector, Mouse MG54369-U
TMEM199 cDNA ORF Clone, Mouse, untagged MG54369-UT
TMEM199 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54369-ACGLN
TMEM199 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54369-ACG
TMEM199 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG54369-ACR
TMEM199 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG54369-CF
TMEM199 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG54369-NF
TMEM199 cDNA ORF Clone, Mouse, C-His tag MG54369-CH
TMEM199 cDNA ORF Clone, Mouse, N-His tag MG54369-NH
TMEM199 cDNA ORF Clone, Mouse, C-HA tag MG54369-CY
TMEM199 cDNA ORF Clone, Mouse, N-HA tag MG54369-NY
TMEM199 cDNA ORF Clone, Mouse, C-Myc tag MG54369-CM
TMEM199 cDNA ORF Clone, Mouse, N-Myc tag MG54369-NM

TMEM199 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM199 cDNA ORF Clone in Cloning Vector, Human HG13417-G
TMEM199 cDNA ORF Clone, Human, untagged HG13417-UT
TMEM199 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13417-ACGLN
TMEM199 cDNA ORF Clone, Human, C-GFPSpark® tag HG13417-ACG
TMEM199 cDNA ORF Clone, Human, C-OFPSpark® tag HG13417-ACR
TMEM199 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13417-NF
TMEM199 cDNA ORF Clone, Human, C-His tag HG13417-CH
TMEM199 cDNA ORF Clone, Human, N-His tag HG13417-NH
TMEM199 cDNA ORF Clone, Human, C-HA tag HG13417-CY
TMEM199 cDNA ORF Clone, Human, N-HA tag HG13417-NY
TMEM199 cDNA ORF Clone, Human, C-Myc tag HG13417-CM
TMEM199 cDNA ORF Clone, Human, N-Myc tag HG13417-NM
TMEM199 qPCR Primer Pairs, Human HP102119
info info
添加购物车成功! 添加购物车失败!