TMEM183A cDNA ORF Clone, Human, C-His tag

Cat: HG12159-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMEM183A Reagents
CRO Services
Product recommended

All TMEM183A Reagents
TMEM183A cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1131 bp
Description
Full length Clone DNA of Human transmembrane protein 183A with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM183A cDNA ORF Clone, Human, C-His tag Alternative Names
C1orf37 cDNA ORF Clone, Human
TMEM183A Background Information
Full Name
transmembrane protein 183A

TMEM183A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM183A cDNA ORF Clone in Cloning Vector, Mouse MG52399-U
TMEM183A cDNA ORF Clone, Mouse, untagged MG52399-UT
TMEM183A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52399-ACGLN
TMEM183A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52399-ACG
TMEM183A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52399-ANG
TMEM183A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52399-ACR
TMEM183A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52399-ANR
TMEM183A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52399-CF
TMEM183A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52399-NF
TMEM183A cDNA ORF Clone, Mouse, C-His tag MG52399-CH
TMEM183A cDNA ORF Clone, Mouse, N-His tag MG52399-NH
TMEM183A cDNA ORF Clone, Mouse, C-HA tag MG52399-CY
TMEM183A cDNA ORF Clone, Mouse, N-HA tag MG52399-NY
TMEM183A cDNA ORF Clone, Mouse, C-Myc tag MG52399-CM
TMEM183A cDNA ORF Clone, Mouse, N-Myc tag MG52399-NM
TMEM183A qPCR Primer Pairs, Mouse MP202272

TMEM183A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM183A cDNA ORF Clone in Cloning Vector, Human HG12159-G
TMEM183A cDNA ORF Clone, Human, untagged HG12159-UT
TMEM183A cDNA ORF Clone, Human, C-GFPSpark® tag HG12159-ACG
TMEM183A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12159-ACGLN
TMEM183A cDNA ORF Clone, Human, C-OFPSpark® tag HG12159-ACR
TMEM183A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12159-CF
TMEM183A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12159-NF
TMEM183A cDNA ORF Clone, Human, N-His tag HG12159-NH
TMEM183A cDNA ORF Clone, Human, C-HA tag HG12159-CY
TMEM183A cDNA ORF Clone, Human, N-HA tag HG12159-NY
TMEM183A cDNA ORF Clone, Human, C-Myc tag HG12159-CM
TMEM183A cDNA ORF Clone, Human, N-Myc tag HG12159-NM
TMEM183A qPCR Primer Pairs, Human HP101793
info info
添加购物车成功! 添加购物车失败!