TMP21 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG13462-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMP21 Reagents
CRO Services
Product recommended

All TMP21 Reagents
TMP21 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
654 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human transmembrane emp24-like trafficking protein 10 (yeast) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + XbaI(6kb+0.65kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TMP21 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMP21 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
TMP21 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
p23 cDNA ORF Clone, Human;P24(DELTA) cDNA ORF Clone, Human;S31I125 cDNA ORF Clone, Human;S31III125 cDNA ORF Clone, Human;Tmp-21-I cDNA ORF Clone, Human;TMP21 cDNA ORF Clone, Human
TMP21 Background Information
Full Name
transmembrane emp24-like trafficking protein 10 (yeast)

TMP21 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
TMP21 cDNA ORF Clone in Cloning Vector, Canine DG70216-U
TMP21 cDNA ORF Clone, Canine, untagged DG70216-UT
TMP21 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70216-ACGLN
TMP21 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70216-ACG
TMP21 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70216-ACR
TMP21 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70216-CF
TMP21 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70216-NF
TMP21 cDNA ORF Clone, Canine, C-His tag DG70216-CH
TMP21 cDNA ORF Clone, Canine, N-His tag DG70216-NH
TMP21 cDNA ORF Clone, Canine, C-HA tag DG70216-CY
TMP21 cDNA ORF Clone, Canine, N-HA tag DG70216-NY
TMP21 cDNA ORF Clone, Canine, C-Myc tag DG70216-CM
TMP21 cDNA ORF Clone, Canine, N-Myc tag DG70216-NM

TMP21 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
TMP21 cDNA ORF Clone in Cloning Vector, Ferret FG60137-G
TMP21 cDNA ORF Clone, Ferret, untagged FG60137-UT
TMP21 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60137-ACGLN
TMP21 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60137-ACG
TMP21 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60137-ACR
TMP21 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60137-CF
TMP21 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60137-NF
TMP21 cDNA ORF Clone, Ferret, C-His tag FG60137-CH
TMP21 cDNA ORF Clone, Ferret, N-His tag FG60137-NH
TMP21 cDNA ORF Clone, Ferret, C-HA tag FG60137-CY
TMP21 cDNA ORF Clone, Ferret, N-HA tag FG60137-NY
TMP21 cDNA ORF Clone, Ferret, C-Myc tag FG60137-CM
TMP21 cDNA ORF Clone, Ferret, N-Myc tag FG60137-NM

TMP21 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TMP21 cDNA ORF Clone in Cloning Vector, Rat RG80511-U
TMP21 cDNA ORF Clone, Rat, untagged RG80511-UT
TMP21 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80511-ACGLN
TMP21 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80511-ACG
TMP21 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80511-ACR
TMP21 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80511-CF
TMP21 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80511-NF
TMP21 cDNA ORF Clone, Rat, C-His tag RG80511-CH
TMP21 cDNA ORF Clone, Rat, N-His tag RG80511-NH
TMP21 cDNA ORF Clone, Rat, C-HA tag RG80511-CY
TMP21 cDNA ORF Clone, Rat, N-HA tag RG80511-NY
TMP21 cDNA ORF Clone, Rat, C-Myc tag RG80511-CM
TMP21 cDNA ORF Clone, Rat, N-Myc tag RG80511-NM
TMP21 qPCR Primer Pairs, Rat RP300475

TMP21 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMP21 cDNA ORF Clone in Cloning Vector, Mouse MG51957-G
TMP21 cDNA ORF Clone, Mouse, untagged MG51957-UT
TMP21 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51957-ACGLN
TMP21 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51957-ACG
TMP21 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51957-ACR
TMP21 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51957-CF
TMP21 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51957-NF
TMP21 cDNA ORF Clone, Mouse, C-His tag MG51957-CH
TMP21 cDNA ORF Clone, Mouse, N-His tag MG51957-NH
TMP21 cDNA ORF Clone, Mouse, C-HA tag MG51957-CY
TMP21 cDNA ORF Clone, Mouse, N-HA tag MG51957-NY
TMP21 cDNA ORF Clone, Mouse, C-Myc tag MG51957-CM
TMP21 cDNA ORF Clone, Mouse, N-Myc tag MG51957-NM
TMP21 qPCR Primer Pairs, Mouse MP201830

TMP21 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMP21 cDNA ORF Clone in Cloning Vector, Human HG13462-G
TMP21 cDNA ORF Clone, Human, untagged HG13462-UT
TMP21 cDNA ORF Clone, Human, C-GFPSpark® tag HG13462-ACG
TMP21 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13462-ACGLN
TMP21 cDNA ORF Clone, Human, C-OFPSpark® tag HG13462-ACR
TMP21 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13462-CF
TMP21 cDNA ORF Clone, Human, C-His tag HG13462-CH
TMP21 cDNA ORF Clone, Human, N-His tag HG13462-NH
TMP21 cDNA ORF Clone, Human, C-HA tag HG13462-CY
TMP21 cDNA ORF Clone, Human, C-HA tag HG13462-G-Y
TMP21 cDNA ORF Clone, Human, N-HA tag HG13462-NY
TMP21 cDNA ORF Clone, Human, C-Myc tag HG13462-CM
TMP21 cDNA ORF Clone, Human, N-Myc tag HG13462-NM
TMP21 qPCR Primer Pairs, Human HP102162
info info
添加购物车成功! 添加购物车失败!