TMCC2 cDNA ORF Clone, Human, N-His tag

Cat: HG13130-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMCC2 Reagents
CRO Services
Product recommended

All TMCC2 Reagents
TMCC2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2130 bp
Description
Full length Clone DNA of Human transmembrane and coiled-coil domain family 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMCC2 cDNA ORF Clone, Human, N-His tag Alternative Names
HUCEP11 cDNA ORF Clone, Human
TMCC2 Background Information
Full Name
transmembrane and coiled-coil domain family 2

TMCC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMCC2 cDNA ORF Clone in Cloning Vector, Mouse MG53219-G
TMCC2 cDNA ORF Clone, Mouse, untagged MG53219-UT
TMCC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53219-ACGLN
TMCC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53219-ACG
TMCC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53219-ACR
TMCC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53219-CF
TMCC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53219-NF
TMCC2 cDNA ORF Clone, Mouse, C-His tag MG53219-CH
TMCC2 cDNA ORF Clone, Mouse, N-His tag MG53219-NH
TMCC2 cDNA ORF Clone, Mouse, C-HA tag MG53219-CY
TMCC2 cDNA ORF Clone, Mouse, N-HA tag MG53219-NY
TMCC2 cDNA ORF Clone, Mouse, C-Myc tag MG53219-CM
TMCC2 cDNA ORF Clone, Mouse, N-Myc tag MG53219-NM

TMCC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMCC2 cDNA ORF Clone in Cloning Vector, Human HG13130-G
TMCC2 cDNA ORF Clone, Human, untagged HG13130-UT
TMCC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13130-ACG
TMCC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13130-ACGLN
TMCC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13130-ACR
TMCC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13130-CF
TMCC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13130-NF
TMCC2 cDNA ORF Clone, Human, C-His tag HG13130-CH
TMCC2 cDNA ORF Clone, Human, C-HA tag HG13130-CY
TMCC2 cDNA ORF Clone, Human, N-HA tag HG13130-NY
TMCC2 cDNA ORF Clone, Human, C-Myc tag HG13130-CM
TMCC2 cDNA ORF Clone, Human, N-Myc tag HG13130-NM
TMCC2 qPCR Primer Pairs, Human HP101750
info info
添加购物车成功! 添加购物车失败!