TLR7 cDNA ORF Clone, Human, C-His tag

Cat: HG11204-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TLR7 Reagents
CRO Services
Product recommended

All TLR7 Reagents
TLR7 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3195 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human toll-like receptor 7 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + XbaI(6kb+3.2kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TLR7 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TLR7 cDNA ORF Clone, Human, C-His tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5610
TLR7 cDNA ORF Clone, Human, C-His tag Alternative Names
TLR7-like cDNA ORF Clone, Human
TLR7 Background Information
Full Name
toll-like receptor 7

TLR7 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TLR7 cDNA ORF Clone in Cloning Vector, Rat RG81480-G

TLR7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TLR7 cDNA ORF Clone in Cloning Vector, Mouse MG50962-G
TLR7 cDNA ORF Clone, Mouse, untagged MG50962-UT
TLR7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50962-ACG
TLR7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50962-ACGLN
TLR7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50962-ACR
TLR7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50962-CF
TLR7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50962-NF
TLR7 cDNA ORF Clone, Mouse, C-His tag MG50962-CH
TLR7 cDNA ORF Clone, Mouse, N-His tag MG50962-NH
TLR7 cDNA ORF Clone, Mouse, C-HA tag MG50962-CY
TLR7 cDNA ORF Clone, Mouse, N-HA tag MG50962-NY
TLR7 cDNA ORF Clone, Mouse, C-Myc tag MG50962-CM
TLR7 cDNA ORF Clone, Mouse, N-Myc tag MG50962-NM
TLR7 qPCR Primer Pairs, Mouse MP200931

TLR7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TLR7 cDNA ORF Clone in Cloning Vector, Human HG11204-M
TLR7 cDNA ORF Clone, Human, untagged HG11204-UT
TLR7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11204-ACGLN
TLR7 cDNA ORF Clone, Human, C-GFPSpark® tag HG11204-ACG
TLR7 cDNA ORF Clone, Human, C-OFPSpark® tag HG11204-ACR
TLR7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11204-CF
TLR7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11204-NF
TLR7 cDNA ORF Clone, Human, N-His tag HG11204-NH
TLR7 cDNA ORF Clone, Human, C-HA tag HG11204-CY
TLR7 cDNA ORF Clone, Human, N-HA tag HG11204-NY
TLR7 cDNA ORF Clone, Human, C-Myc tag HG11204-CM
TLR7 cDNA ORF Clone, Human, N-Myc tag HG11204-NM
TLR7 qPCR Primer Pairs, Human HP101190
info info
添加购物车成功! 添加购物车失败!