TLR4 cDNA ORF Clone, Human, N-His tag

Cat: HG10146-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TLR4 Reagents
CRO Services
Product recommended

All TLR4 Reagents
TLR4 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2520 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human toll-like receptor 4, transcript variant 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Restriction Sites
KpnI + NotI (6kb + 2.57kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TLR4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TLR4 cDNA ORF Clone, Human, N-His tag Validated Images
Human IL12A / IL-12A Gene Plasmid Map 5646
TLR4 cDNA ORF Clone, Human, N-His tag Alternative Names
ARMD10 cDNA ORF Clone, Human;CD284 cDNA ORF Clone, Human;TLR-4 cDNA ORF Clone, Human;TLR4 cDNA ORF Clone, Human;TOLL cDNA ORF Clone, Human
TLR4 Background Information

TLR4, also known as TLR-4, is a member of the Toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. TLR4 is most abundantly expressed in placenta, and in myelomonocytic subpopulation of the leukocytes. TLR 4 has also been designated as CD284 (cluster of differentiation 284). It has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. TLR4 Cooperates with LY96 and CD14 to mediate the innate immune response to bacterial lipopolysaccharide (LPS). It acts via MYD88, TIRAP and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. It is also involved in LPS-independent inflammatory responses triggered by Ni(2+).

Full Name
toll-like receptor 4
Research Areas
References
  • Re, Fabio, et al. (2002) Monomeric recombinant MD-2 binds toll-like receptor 4 tightly and confers lipopolysaccharide responsiveness. J Biol Chem. 277(26):23427-32.
  • Shimazu, R, et al. (1999) MD-2, a Molecule that Confers Lipopolysaccharide Responsiveness on Toll-like Receptor 4. J Exp Med. 189(11):1777-82.
  • Blanco, A M, et al. (2005) Involvement of TLR4/type I IL-1 receptor signaling in the induction of inflammatory mediators and cell death induced by ethanol in cultured astrocytes. Journal of immunology. 175(10):6893-9.
  • TLR4 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    TLR4 cDNA ORF Clone in Cloning Vector, Rhesus CG90258-G
    TLR4 cDNA ORF Clone, Rhesus, untagged CG90258-UT
    TLR4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90258-ACGLN
    TLR4 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90258-ACG
    TLR4 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90258-ACR
    TLR4 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90258-CF
    TLR4 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90258-NF
    TLR4 cDNA ORF Clone, Rhesus, C-His tag CG90258-CH
    TLR4 cDNA ORF Clone, Rhesus, N-His tag CG90258-NH
    TLR4 cDNA ORF Clone, Rhesus, C-HA tag CG90258-CY
    TLR4 cDNA ORF Clone, Rhesus, N-HA tag CG90258-NY
    TLR4 cDNA ORF Clone, Rhesus, C-Myc tag CG90258-CM
    TLR4 cDNA ORF Clone, Rhesus, N-Myc tag CG90258-NM

    TLR4 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TLR4 cDNA ORF Clone in Cloning Vector, Rat RG80389-G
    TLR4 cDNA ORF Clone, Rat, untagged RG80389-UT
    TLR4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80389-ACGLN
    TLR4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80389-ACG
    TLR4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80389-ACR
    TLR4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80389-CF
    TLR4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80389-NF
    TLR4 cDNA ORF Clone, Rat, C-His tag RG80389-CH
    TLR4 cDNA ORF Clone, Rat, N-His tag RG80389-NH
    TLR4 cDNA ORF Clone, Rat, C-HA tag RG80389-CY
    TLR4 cDNA ORF Clone, Rat, N-HA tag RG80389-NY
    TLR4 cDNA ORF Clone, Rat, C-Myc tag RG80389-CM
    TLR4 cDNA ORF Clone, Rat, N-Myc tag RG80389-NM
    TLR4 qPCR Primer Pairs, Rat RP300355

    TLR4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TLR4 cDNA ORF Clone in Cloning Vector, Mouse MG50657-M
    TLR4 cDNA ORF Clone, Mouse, untagged MG50657-UT
    TLR4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50657-ACGLN
    TLR4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50657-ACG
    TLR4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50657-ACR
    TLR4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50657-CF
    TLR4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50657-NF
    TLR4 cDNA ORF Clone, Mouse, C-His tag MG50657-CH
    TLR4 cDNA ORF Clone, Mouse, N-His tag MG50657-NH
    TLR4 cDNA ORF Clone, Mouse, C-HA tag MG50657-CY
    TLR4 cDNA ORF Clone, Mouse, N-HA tag MG50657-NY
    TLR4 cDNA ORF Clone, Mouse, C-Myc tag MG50657-CM
    TLR4 cDNA ORF Clone, Mouse, N-Myc tag MG50657-NM
    TLR4 qPCR Primer Pairs, Mouse MP200636

    TLR4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TLR4 cDNA ORF Clone in Cloning Vector, Human HG10146-M
    TLR4 cDNA ORF Clone, Human, untagged HG10146-UT
    TLR4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10146-ACG
    TLR4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10146-ACGLN
    TLR4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10146-ACR
    TLR4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10146-CF
    TLR4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10146-NF
    TLR4 cDNA ORF Clone, Human, C-His tag HG10146-CH
    TLR4 cDNA ORF Clone, Human, C-HA tag HG10146-CY
    TLR4 cDNA ORF Clone, Human, N-HA tag HG10146-NY
    TLR4 cDNA ORF Clone, Human, C-Myc tag HG10146-CM
    TLR4 cDNA ORF Clone, Human, N-Myc tag HG10146-NM
    TLR4 qPCR Primer Pairs, Human HP100217
    info info
    添加购物车成功! 添加购物车失败!