TIPRL cDNA ORF Clone, Human, N-HA tag

Cat: HG14166-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TIPRL Reagents
CRO Services
Product recommended

All TIPRL Reagents
TIPRL cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
537 bp
Description
Full length Clone DNA of Human TIP41, TOR signaling pathway regulator-like (S. cerevisiae) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TIPRL cDNA ORF Clone, Human, N-HA tag Alternative Names
TIP cDNA ORF Clone, Human;TIP41 cDNA ORF Clone, Human
TIPRL Background Information
Full Name
TOR signaling pathway regulator

TIPRL cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TIPRL cDNA ORF Clone in Cloning Vector, Rat RG8A0961-U
TIPRL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0961-ACGLN

TIPRL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TIPRL cDNA ORF Clone in Cloning Vector, Mouse MG52324-G
TIPRL cDNA ORF Clone, Mouse, untagged MG52324-UT
TIPRL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52324-ACG
TIPRL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52324-ACGLN
TIPRL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52324-ANG
TIPRL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52324-ACR
TIPRL cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52324-ANR
TIPRL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52324-CF
TIPRL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52324-NF
TIPRL cDNA ORF Clone, Mouse, C-His tag MG52324-CH
TIPRL cDNA ORF Clone, Mouse, N-His tag MG52324-NH
TIPRL cDNA ORF Clone, Mouse, C-HA tag MG52324-CY
TIPRL cDNA ORF Clone, Mouse, N-HA tag MG52324-NY
TIPRL cDNA ORF Clone, Mouse, C-Myc tag MG52324-CM
TIPRL cDNA ORF Clone, Mouse, N-Myc tag MG52324-NM
TIPRL qPCR Primer Pairs, Mouse MP202197

TIPRL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TIPRL cDNA ORF Clone in Cloning Vector, Human HG14166-G
TIPRL cDNA ORF Clone, Human, untagged HG14166-UT
TIPRL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14166-ACGLN
TIPRL cDNA ORF Clone, Human, C-GFPSpark® tag HG14166-ACG
TIPRL cDNA ORF Clone, Human, N-GFPSpark® tag HG14166-ANG
TIPRL cDNA ORF Clone, Human, C-OFPSpark® tag HG14166-ACR
TIPRL cDNA ORF Clone, Human, N-OFPSpark® tag HG14166-ANR
TIPRL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14166-CF
TIPRL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14166-NF
TIPRL cDNA ORF Clone, Human, C-His tag HG14166-CH
TIPRL cDNA ORF Clone, Human, N-His tag HG14166-NH
TIPRL cDNA ORF Clone, Human, C-HA tag HG14166-CY
TIPRL cDNA ORF Clone, Human, C-Myc tag HG14166-CM
TIPRL cDNA ORF Clone, Human, N-Myc tag HG14166-NM
TIPRL qPCR Primer Pairs, Human HP102817
info info
添加购物车成功! 添加购物车失败!